Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639157_at:

>probe:Drosophila_2:1639157_at:155:679; Interrogation_Position=2780; Antisense; TAGTTTTAGCTATTTATCCCATGTA
>probe:Drosophila_2:1639157_at:117:341; Interrogation_Position=2788; Antisense; GCTATTTATCCCATGTATTTACCGT
>probe:Drosophila_2:1639157_at:185:481; Interrogation_Position=2802; Antisense; GTATTTACCGTAACAACAACGCGCA
>probe:Drosophila_2:1639157_at:194:161; Interrogation_Position=2817; Antisense; ACAACGCGCAATTGATTCGGGAAAA
>probe:Drosophila_2:1639157_at:11:603; Interrogation_Position=2873; Antisense; TGTTTACCATTTGCGGACATTTTTA
>probe:Drosophila_2:1639157_at:25:239; Interrogation_Position=2921; Antisense; AATCATCCACTTGAGTTTTCAAAAG
>probe:Drosophila_2:1639157_at:543:381; Interrogation_Position=2958; Antisense; GAAATCCCATTTGTAGGACCAAAAG
>probe:Drosophila_2:1639157_at:431:353; Interrogation_Position=2982; Antisense; GCAGCGAAAGGATCTTTTTACATTT
>probe:Drosophila_2:1639157_at:474:719; Interrogation_Position=3021; Antisense; TTCCAGCAGCAAGTGTAGTTGTCAT
>probe:Drosophila_2:1639157_at:584:693; Interrogation_Position=3056; Antisense; TTTCCAATTTGGTTTTTCGAATGCA
>probe:Drosophila_2:1639157_at:641:659; Interrogation_Position=3089; Antisense; TAACAACTATTTATCGCGACTCAAT
>probe:Drosophila_2:1639157_at:131:405; Interrogation_Position=3106; Antisense; GACTCAATGATGTCAGCAACTCTGT
>probe:Drosophila_2:1639157_at:328:479; Interrogation_Position=3210; Antisense; GTTTGATTTCGAAAGTCCGCCGATC
>probe:Drosophila_2:1639157_at:492:487; Interrogation_Position=3276; Antisense; GTACGTAGTAGTTCCGAGGTTCAAT

Paste this into a BLAST search page for me
TAGTTTTAGCTATTTATCCCATGTAGCTATTTATCCCATGTATTTACCGTGTATTTACCGTAACAACAACGCGCAACAACGCGCAATTGATTCGGGAAAATGTTTACCATTTGCGGACATTTTTAAATCATCCACTTGAGTTTTCAAAAGGAAATCCCATTTGTAGGACCAAAAGGCAGCGAAAGGATCTTTTTACATTTTTCCAGCAGCAAGTGTAGTTGTCATTTTCCAATTTGGTTTTTCGAATGCATAACAACTATTTATCGCGACTCAATGACTCAATGATGTCAGCAACTCTGTGTTTGATTTCGAAAGTCCGCCGATCGTACGTAGTAGTTCCGAGGTTCAAT

Full Affymetrix probeset data:

Annotations for 1639157_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime