FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639158_at:

>probe:Drosophila_2:1639158_at:283:591; Interrogation_Position=129; Antisense; TGGTCCTTGCGCGATGATTGGTCCC
>probe:Drosophila_2:1639158_at:350:3; Interrogation_Position=145; Antisense; ATTGGTCCCCGCTTGGAGCAACTGG
>probe:Drosophila_2:1639158_at:442:195; Interrogation_Position=164; Antisense; AACTGGCATCGGATTACTTCGGACG
>probe:Drosophila_2:1639158_at:700:665; Interrogation_Position=178; Antisense; TACTTCGGACGGATGTTGGTCCTTA
>probe:Drosophila_2:1639158_at:237:375; Interrogation_Position=223; Antisense; GAAGATCTGGCCGTTCAGTACGAAG
>probe:Drosophila_2:1639158_at:380:487; Interrogation_Position=240; Antisense; GTACGAAGTCAACAGCATGCCCACA
>probe:Drosophila_2:1639158_at:512:269; Interrogation_Position=255; Antisense; CATGCCCACATTTCTGATCATCAAA
>probe:Drosophila_2:1639158_at:330:157; Interrogation_Position=289; Antisense; ACACTAATCCAGTTCGTGGGCGGCA
>probe:Drosophila_2:1639158_at:660:59; Interrogation_Position=314; Antisense; ATGTCGAAAGGGTCGTCAGCACGGT
>probe:Drosophila_2:1639158_at:721:81; Interrogation_Position=389; Antisense; AGGGAGGTGCTAGTTCAGCTACCGT
>probe:Drosophila_2:1639158_at:666:469; Interrogation_Position=401; Antisense; GTTCAGCTACCGTGCCGAAATTGGA
>probe:Drosophila_2:1639158_at:351:657; Interrogation_Position=66; Antisense; TAAGCTCATCGATGATGCGGGAACC
>probe:Drosophila_2:1639158_at:24:621; Interrogation_Position=81; Antisense; TGCGGGAACCAACAAATACGTACTT
>probe:Drosophila_2:1639158_at:527:27; Interrogation_Position=96; Antisense; ATACGTACTTGTCGAGTTCTTCGCC

Paste this into a BLAST search page for me
TGGTCCTTGCGCGATGATTGGTCCCATTGGTCCCCGCTTGGAGCAACTGGAACTGGCATCGGATTACTTCGGACGTACTTCGGACGGATGTTGGTCCTTAGAAGATCTGGCCGTTCAGTACGAAGGTACGAAGTCAACAGCATGCCCACACATGCCCACATTTCTGATCATCAAAACACTAATCCAGTTCGTGGGCGGCAATGTCGAAAGGGTCGTCAGCACGGTAGGGAGGTGCTAGTTCAGCTACCGTGTTCAGCTACCGTGCCGAAATTGGATAAGCTCATCGATGATGCGGGAACCTGCGGGAACCAACAAATACGTACTTATACGTACTTGTCGAGTTCTTCGCC

Full Affymetrix probeset data:

Annotations for 1639158_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720