Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639159_at:

>probe:Drosophila_2:1639159_at:647:713; Interrogation_Position=1133; Antisense; TTCGATTTGACCTCCCAAACATGGA
>probe:Drosophila_2:1639159_at:699:603; Interrogation_Position=1237; Antisense; TGTTGATAAGCCAGTGACCACCACC
>probe:Drosophila_2:1639159_at:83:547; Interrogation_Position=1264; Antisense; GGATGGCATTTTCACGGTCACCGTT
>probe:Drosophila_2:1639159_at:519:1; Interrogation_Position=1286; Antisense; GTTGGCGGTCCCAGTACCAGTACCA
>probe:Drosophila_2:1639159_at:603:7; Interrogation_Position=1315; Antisense; ATTCGTGTCCAAAATACCCAGCCTA
>probe:Drosophila_2:1639159_at:483:175; Interrogation_Position=1346; Antisense; AAACCCAAGCCGACGAATGTGCCAT
>probe:Drosophila_2:1639159_at:720:369; Interrogation_Position=1360; Antisense; GAATGTGCCATCTCCGCGCATGAAT
>probe:Drosophila_2:1639159_at:435:615; Interrogation_Position=1380; Antisense; TGAATCCCGGCATGTGCGTGTGCAA
>probe:Drosophila_2:1639159_at:438:135; Interrogation_Position=1409; Antisense; ACGCTGTATATTTTCGGTGGCATCT
>probe:Drosophila_2:1639159_at:172:467; Interrogation_Position=1453; Antisense; GTTGACCTACAACGATTTCTACGCC
>probe:Drosophila_2:1639159_at:443:319; Interrogation_Position=1475; Antisense; GCCCTGGACTTGCACAAACTGGAAT
>probe:Drosophila_2:1639159_at:720:561; Interrogation_Position=1500; Antisense; GGAAGGTGCTAATCCCCAATAGCTT
>probe:Drosophila_2:1639159_at:330:437; Interrogation_Position=1586; Antisense; GAGGAGGATATCTCCAGCAGCAGCT
>probe:Drosophila_2:1639159_at:152:115; Interrogation_Position=1601; Antisense; AGCAGCAGCTCGGACATGGACACGG

Paste this into a BLAST search page for me
TTCGATTTGACCTCCCAAACATGGATGTTGATAAGCCAGTGACCACCACCGGATGGCATTTTCACGGTCACCGTTGTTGGCGGTCCCAGTACCAGTACCAATTCGTGTCCAAAATACCCAGCCTAAAACCCAAGCCGACGAATGTGCCATGAATGTGCCATCTCCGCGCATGAATTGAATCCCGGCATGTGCGTGTGCAAACGCTGTATATTTTCGGTGGCATCTGTTGACCTACAACGATTTCTACGCCGCCCTGGACTTGCACAAACTGGAATGGAAGGTGCTAATCCCCAATAGCTTGAGGAGGATATCTCCAGCAGCAGCTAGCAGCAGCTCGGACATGGACACGG

Full Affymetrix probeset data:

Annotations for 1639159_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime