FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639160_at:

>probe:Drosophila_2:1639160_at:725:609; Interrogation_Position=3782; Antisense; TGAAACAGCCGGCAAGTCCTGGGCT
>probe:Drosophila_2:1639160_at:350:219; Interrogation_Position=3795; Antisense; AAGTCCTGGGCTGCTTTATCGCCAA
>probe:Drosophila_2:1639160_at:457:279; Interrogation_Position=3834; Antisense; CTACTGTGGCCCAGCGGATGCAGTT
>probe:Drosophila_2:1639160_at:90:533; Interrogation_Position=3865; Antisense; GGTGCTGTTCCACAAGTTGTACCAG
>probe:Drosophila_2:1639160_at:323:89; Interrogation_Position=3888; Antisense; AGTAAATGCCTCTGTTCCCGCGGAA
>probe:Drosophila_2:1639160_at:649:329; Interrogation_Position=3907; Antisense; GCGGAACAGAACTACTCCACGGCCA
>probe:Drosophila_2:1639160_at:256:309; Interrogation_Position=4014; Antisense; CCAGTACTACCAGCATCACGGGATG
>probe:Drosophila_2:1639160_at:355:461; Interrogation_Position=4072; Antisense; GATTCGGACTACTCGACCCTGGATA
>probe:Drosophila_2:1639160_at:503:411; Interrogation_Position=4086; Antisense; GACCCTGGATAACGAGCAGCACATG
>probe:Drosophila_2:1639160_at:662:151; Interrogation_Position=4106; Antisense; ACATGCTGATGATGCCGGGTGCACC
>probe:Drosophila_2:1639160_at:289:1; Interrogation_Position=4211; Antisense; AGGCCGGAACACTGGGCTCTAAAGC
>probe:Drosophila_2:1639160_at:574:351; Interrogation_Position=4284; Antisense; GCAGCAACCAAATCCGACAGCCGTG
>probe:Drosophila_2:1639160_at:565:123; Interrogation_Position=4302; Antisense; AGCCGTGTCCGGACAACAGCAGGGA
>probe:Drosophila_2:1639160_at:500:81; Interrogation_Position=4322; Antisense; AGGGACCCCATGTTCAGGCGTATCT

Paste this into a BLAST search page for me
TGAAACAGCCGGCAAGTCCTGGGCTAAGTCCTGGGCTGCTTTATCGCCAACTACTGTGGCCCAGCGGATGCAGTTGGTGCTGTTCCACAAGTTGTACCAGAGTAAATGCCTCTGTTCCCGCGGAAGCGGAACAGAACTACTCCACGGCCACCAGTACTACCAGCATCACGGGATGGATTCGGACTACTCGACCCTGGATAGACCCTGGATAACGAGCAGCACATGACATGCTGATGATGCCGGGTGCACCAGGCCGGAACACTGGGCTCTAAAGCGCAGCAACCAAATCCGACAGCCGTGAGCCGTGTCCGGACAACAGCAGGGAAGGGACCCCATGTTCAGGCGTATCT

Full Affymetrix probeset data:

Annotations for 1639160_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720