FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639162_at:

>probe:Drosophila_2:1639162_at:626:111; Interrogation_Position=1429; Antisense; AGCTACGTTCGTATGTTTGTATTAA
>probe:Drosophila_2:1639162_at:635:709; Interrogation_Position=1450; Antisense; TTAATAGGCACTCGAACTCCCATAC
>probe:Drosophila_2:1639162_at:77:707; Interrogation_Position=1498; Antisense; TTCAAGCGTAGCATTTACCCCAGTT
>probe:Drosophila_2:1639162_at:307:671; Interrogation_Position=1513; Antisense; TACCCCAGTTGGCTTCTGATACAAG
>probe:Drosophila_2:1639162_at:141:473; Interrogation_Position=1537; Antisense; GTTCATTGGCTAACAACCGCATCTA
>probe:Drosophila_2:1639162_at:684:345; Interrogation_Position=1555; Antisense; GCATCTAGATGTGTTTATCTCGCGA
>probe:Drosophila_2:1639162_at:370:685; Interrogation_Position=1570; Antisense; TATCTCGCGATTTGAGTGTGTCTAT
>probe:Drosophila_2:1639162_at:497:59; Interrogation_Position=1609; Antisense; ATGTTAAGCCATCGCAAATACCTGC
>probe:Drosophila_2:1639162_at:530:15; Interrogation_Position=1647; Antisense; ATATATCTCTGTGTACCTTCGACGG
>probe:Drosophila_2:1639162_at:588:665; Interrogation_Position=1660; Antisense; TACCTTCGACGGGAAATCGCTGACA
>probe:Drosophila_2:1639162_at:224:45; Interrogation_Position=1675; Antisense; ATCGCTGACAGAGGCGCTACCGAGA
>probe:Drosophila_2:1639162_at:519:381; Interrogation_Position=1698; Antisense; GAACCGCGATCCGAAATCCCAGATA
>probe:Drosophila_2:1639162_at:76:245; Interrogation_Position=1755; Antisense; AATTCTAAGCCAGCGAAATCGTGTA
>probe:Drosophila_2:1639162_at:467:43; Interrogation_Position=1785; Antisense; ATCGCATCAGATATCGGCATACACA

Paste this into a BLAST search page for me
AGCTACGTTCGTATGTTTGTATTAATTAATAGGCACTCGAACTCCCATACTTCAAGCGTAGCATTTACCCCAGTTTACCCCAGTTGGCTTCTGATACAAGGTTCATTGGCTAACAACCGCATCTAGCATCTAGATGTGTTTATCTCGCGATATCTCGCGATTTGAGTGTGTCTATATGTTAAGCCATCGCAAATACCTGCATATATCTCTGTGTACCTTCGACGGTACCTTCGACGGGAAATCGCTGACAATCGCTGACAGAGGCGCTACCGAGAGAACCGCGATCCGAAATCCCAGATAAATTCTAAGCCAGCGAAATCGTGTAATCGCATCAGATATCGGCATACACA

Full Affymetrix probeset data:

Annotations for 1639162_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720