Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639164_at:

>probe:Drosophila_2:1639164_at:132:545; Interrogation_Position=123; Antisense; GGATCCCAAGCAGAGCGAGGTGTCT
>probe:Drosophila_2:1639164_at:460:599; Interrogation_Position=143; Antisense; TGTCTTCCGCGGAGGCTGAGCTACA
>probe:Drosophila_2:1639164_at:200:715; Interrogation_Position=233; Antisense; TTCTGGCCGGTGAATTGGTACCCGA
>probe:Drosophila_2:1639164_at:239:455; Interrogation_Position=297; Antisense; GATCACGTGCCTGCTGGACAAGATA
>probe:Drosophila_2:1639164_at:160:31; Interrogation_Position=319; Antisense; ATACACAAGTTTCTGGCCGGGATCG
>probe:Drosophila_2:1639164_at:706:417; Interrogation_Position=343; Antisense; GAGCGGCAGGCCAATATCTTCAAGC
>probe:Drosophila_2:1639164_at:603:549; Interrogation_Position=378; Antisense; GGAGCGGGCGCTTTACCTGTACATG
>probe:Drosophila_2:1639164_at:544:667; Interrogation_Position=397; Antisense; TACATGCTCGGTGTGGACGTGTCCA
>probe:Drosophila_2:1639164_at:75:409; Interrogation_Position=412; Antisense; GACGTGTCCATTCGACGCCAGAGAG
>probe:Drosophila_2:1639164_at:555:199; Interrogation_Position=514; Antisense; AACCAGAACTCCAAACGCCTTATGA
>probe:Drosophila_2:1639164_at:129:413; Interrogation_Position=537; Antisense; GACCGCCCTAAACATGGAGTGCATA
>probe:Drosophila_2:1639164_at:131:461; Interrogation_Position=571; Antisense; GATTACGCGGACTACAAGGACGAGC
>probe:Drosophila_2:1639164_at:479:635; Interrogation_Position=74; Antisense; TCGCAGTGCACTTCTTCAAGCAGGA
>probe:Drosophila_2:1639164_at:284:209; Interrogation_Position=91; Antisense; AAGCAGGAGCCGCTAATGCTGATCC

Paste this into a BLAST search page for me
GGATCCCAAGCAGAGCGAGGTGTCTTGTCTTCCGCGGAGGCTGAGCTACATTCTGGCCGGTGAATTGGTACCCGAGATCACGTGCCTGCTGGACAAGATAATACACAAGTTTCTGGCCGGGATCGGAGCGGCAGGCCAATATCTTCAAGCGGAGCGGGCGCTTTACCTGTACATGTACATGCTCGGTGTGGACGTGTCCAGACGTGTCCATTCGACGCCAGAGAGAACCAGAACTCCAAACGCCTTATGAGACCGCCCTAAACATGGAGTGCATAGATTACGCGGACTACAAGGACGAGCTCGCAGTGCACTTCTTCAAGCAGGAAAGCAGGAGCCGCTAATGCTGATCC

Full Affymetrix probeset data:

Annotations for 1639164_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime