FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639167_at:

>probe:Drosophila_2:1639167_at:660:133; Interrogation_Position=1073; Antisense; ACCCTACCTCGCTAAGGATTGTGGA
>probe:Drosophila_2:1639167_at:462:623; Interrogation_Position=1140; Antisense; TGCGATTCTGGTATTCTTGCTCGAA
>probe:Drosophila_2:1639167_at:154:275; Interrogation_Position=1155; Antisense; CTTGCTCGAAGTTTCTTGGCACAGA
>probe:Drosophila_2:1639167_at:268:209; Interrogation_Position=635; Antisense; AAGCACGAAGTTTCGCTGGTCTGCG
>probe:Drosophila_2:1639167_at:641:327; Interrogation_Position=657; Antisense; GCGTCGCACGAAAATACCATTGGTT
>probe:Drosophila_2:1639167_at:11:439; Interrogation_Position=688; Antisense; GAGGAAGACTTTCCCACATGGATGA
>probe:Drosophila_2:1639167_at:76:547; Interrogation_Position=707; Antisense; GGATGAAACTGCGTGTGCCCATGCT
>probe:Drosophila_2:1639167_at:727:631; Interrogation_Position=794; Antisense; TCGCCTCCCGACTGTATTGGAATTT
>probe:Drosophila_2:1639167_at:34:109; Interrogation_Position=833; Antisense; AGAAGCGCTTCACCCGAGAGCTGTT
>probe:Drosophila_2:1639167_at:437:425; Interrogation_Position=848; Antisense; GAGAGCTGTTTATCTACTCCACGGA
>probe:Drosophila_2:1639167_at:142:689; Interrogation_Position=904; Antisense; TTCCAATGGCCGCAGAATTCCTTGT
>probe:Drosophila_2:1639167_at:580:109; Interrogation_Position=917; Antisense; AGAATTCCTTGTTCACAGAGCCCGT
>probe:Drosophila_2:1639167_at:602:123; Interrogation_Position=935; Antisense; AGCCCGTCAGCCAACTTATTTTGGA
>probe:Drosophila_2:1639167_at:363:229; Interrogation_Position=970; Antisense; AATGGACTCTATGACTTCTGGGTGG

Paste this into a BLAST search page for me
ACCCTACCTCGCTAAGGATTGTGGATGCGATTCTGGTATTCTTGCTCGAACTTGCTCGAAGTTTCTTGGCACAGAAAGCACGAAGTTTCGCTGGTCTGCGGCGTCGCACGAAAATACCATTGGTTGAGGAAGACTTTCCCACATGGATGAGGATGAAACTGCGTGTGCCCATGCTTCGCCTCCCGACTGTATTGGAATTTAGAAGCGCTTCACCCGAGAGCTGTTGAGAGCTGTTTATCTACTCCACGGATTCCAATGGCCGCAGAATTCCTTGTAGAATTCCTTGTTCACAGAGCCCGTAGCCCGTCAGCCAACTTATTTTGGAAATGGACTCTATGACTTCTGGGTGG

Full Affymetrix probeset data:

Annotations for 1639167_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720