FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639168_at:

>probe:Drosophila_2:1639168_at:173:159; Interrogation_Position=1031; Antisense; ACAAGCGTGTTGTGGCCAAGACATT
>probe:Drosophila_2:1639168_at:574:5; Interrogation_Position=1069; Antisense; ATTGTTGTGCCCTTTGACCAGAAGA
>probe:Drosophila_2:1639168_at:680:397; Interrogation_Position=1092; Antisense; GACAGAAGTGGGATACCGCCCGCTG
>probe:Drosophila_2:1639168_at:677:581; Interrogation_Position=1115; Antisense; TGGCTGTCAGCGATTCCGAACTCAA
>probe:Drosophila_2:1639168_at:178:75; Interrogation_Position=1166; Antisense; AGGACGTCGATAATGGAGCCGCCAA
>probe:Drosophila_2:1639168_at:533:613; Interrogation_Position=1248; Antisense; TGAATCGGACTTTGGAAGCGCCCTG
>probe:Drosophila_2:1639168_at:407:205; Interrogation_Position=1263; Antisense; AAGCGCCCTGGAACTAGGCATCGAT
>probe:Drosophila_2:1639168_at:304:271; Interrogation_Position=1281; Antisense; CATCGATATGTTCTGCAGTGGGCAC
>probe:Drosophila_2:1639168_at:637:51; Interrogation_Position=1318; Antisense; ATGCTTGCCTCATCGTTGCTGGTAC
>probe:Drosophila_2:1639168_at:12:589; Interrogation_Position=1337; Antisense; TGGTACCCGCCTATTCAATGCTTTC
>probe:Drosophila_2:1639168_at:238:227; Interrogation_Position=1387; Antisense; AAGGCGCACATGGAGCAACGTAGTC
>probe:Drosophila_2:1639168_at:139:549; Interrogation_Position=1413; Antisense; GGAGGACAACCTCAGCATTTTTGAT
>probe:Drosophila_2:1639168_at:413:715; Interrogation_Position=1450; Antisense; TTCGATTTTTATTCCGCAACCGTAT
>probe:Drosophila_2:1639168_at:195:85; Interrogation_Position=979; Antisense; AGTGACAATTCCCTAGAACTGGCCC

Paste this into a BLAST search page for me
ACAAGCGTGTTGTGGCCAAGACATTATTGTTGTGCCCTTTGACCAGAAGAGACAGAAGTGGGATACCGCCCGCTGTGGCTGTCAGCGATTCCGAACTCAAAGGACGTCGATAATGGAGCCGCCAATGAATCGGACTTTGGAAGCGCCCTGAAGCGCCCTGGAACTAGGCATCGATCATCGATATGTTCTGCAGTGGGCACATGCTTGCCTCATCGTTGCTGGTACTGGTACCCGCCTATTCAATGCTTTCAAGGCGCACATGGAGCAACGTAGTCGGAGGACAACCTCAGCATTTTTGATTTCGATTTTTATTCCGCAACCGTATAGTGACAATTCCCTAGAACTGGCCC

Full Affymetrix probeset data:

Annotations for 1639168_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720