FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639169_at:

>probe:Drosophila_2:1639169_at:672:115; Interrogation_Position=1001; Antisense; AGCATCTGTTCCATTAATCCACTAC
>probe:Drosophila_2:1639169_at:226:243; Interrogation_Position=1142; Antisense; AATTTCTAATAACTACACCGCTGGG
>probe:Drosophila_2:1639169_at:497:321; Interrogation_Position=1170; Antisense; GCCCAGCTCAGCAGAACTACTATGT
>probe:Drosophila_2:1639169_at:665:559; Interrogation_Position=1209; Antisense; GGAAAGACCACCCTATTCACATAGC
>probe:Drosophila_2:1639169_at:147:713; Interrogation_Position=1224; Antisense; TTCACATAGCTTTTGCCTTTGTTGC
>probe:Drosophila_2:1639169_at:88:505; Interrogation_Position=1266; Antisense; GTCCGGAGATAACCTCTGCTAATCA
>probe:Drosophila_2:1639169_at:480:655; Interrogation_Position=1285; Antisense; TAATCACGCCCAATGCATCGGGAGA
>probe:Drosophila_2:1639169_at:713:509; Interrogation_Position=1316; Antisense; GTGACAGCGAAACTGCCGGACAGCT
>probe:Drosophila_2:1639169_at:27:283; Interrogation_Position=1328; Antisense; CTGCCGGACAGCTTGGTTAGTATCA
>probe:Drosophila_2:1639169_at:472:305; Interrogation_Position=799; Antisense; CCGGCAGTCCGGTAATGGGCATCAT
>probe:Drosophila_2:1639169_at:568:409; Interrogation_Position=837; Antisense; GACGAGTTCGTCTTTTTGGCAGGCA
>probe:Drosophila_2:1639169_at:373:349; Interrogation_Position=855; Antisense; GCAGGCATTGCCTCATATGGACAAC
>probe:Drosophila_2:1639169_at:319:21; Interrogation_Position=881; Antisense; ATATTGCTACTCTGCTGGTATTCCA
>probe:Drosophila_2:1639169_at:159:255; Interrogation_Position=944; Antisense; CAAAGCGAATTTGGCTCCCTAATTT

Paste this into a BLAST search page for me
AGCATCTGTTCCATTAATCCACTACAATTTCTAATAACTACACCGCTGGGGCCCAGCTCAGCAGAACTACTATGTGGAAAGACCACCCTATTCACATAGCTTCACATAGCTTTTGCCTTTGTTGCGTCCGGAGATAACCTCTGCTAATCATAATCACGCCCAATGCATCGGGAGAGTGACAGCGAAACTGCCGGACAGCTCTGCCGGACAGCTTGGTTAGTATCACCGGCAGTCCGGTAATGGGCATCATGACGAGTTCGTCTTTTTGGCAGGCAGCAGGCATTGCCTCATATGGACAACATATTGCTACTCTGCTGGTATTCCACAAAGCGAATTTGGCTCCCTAATTT

Full Affymetrix probeset data:

Annotations for 1639169_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720