FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639170_at:

>probe:Drosophila_2:1639170_at:292:3; Interrogation_Position=1280; Antisense; ATTGGCGAAATAACCATTCCTGGCA
>probe:Drosophila_2:1639170_at:552:655; Interrogation_Position=1320; Antisense; TAATGCCCTACTATGTCTACCGAGA
>probe:Drosophila_2:1639170_at:142:365; Interrogation_Position=1349; Antisense; GAATACTTTCCGGATCCTCTAGTCT
>probe:Drosophila_2:1639170_at:67:547; Interrogation_Position=1360; Antisense; GGATCCTCTAGTCTTCAAGCCGGAA
>probe:Drosophila_2:1639170_at:460:543; Interrogation_Position=1393; Antisense; GGATATGAAAACCACCTCGAATACC
>probe:Drosophila_2:1639170_at:324:365; Interrogation_Position=1411; Antisense; GAATACCCCACCTTTAGCATATATT
>probe:Drosophila_2:1639170_at:411:687; Interrogation_Position=1432; Antisense; TATTCCGTTTAGTTCAGGGCCCAAG
>probe:Drosophila_2:1639170_at:410:81; Interrogation_Position=1465; Antisense; AGGGCAGAAATTCGCCAACCTTCAA
>probe:Drosophila_2:1639170_at:327:277; Interrogation_Position=1499; Antisense; CTTATTAGTAAGGTCATTCGGCATT
>probe:Drosophila_2:1639170_at:67:15; Interrogation_Position=1521; Antisense; ATTACGAACTTCTACCGCTTGGTGC
>probe:Drosophila_2:1639170_at:282:545; Interrogation_Position=1546; Antisense; GGATCTTAAAGCTACGTACACATTC
>probe:Drosophila_2:1639170_at:316:13; Interrogation_Position=1567; Antisense; ATTCATATTGAGTTCCTCTACGGGA
>probe:Drosophila_2:1639170_at:371:527; Interrogation_Position=1588; Antisense; GGGAAATAATGTTGGCCTCAAGCCA
>probe:Drosophila_2:1639170_at:183:179; Interrogation_Position=1803; Antisense; AAACTACTACTGCTAGTGCTACATA

Paste this into a BLAST search page for me
ATTGGCGAAATAACCATTCCTGGCATAATGCCCTACTATGTCTACCGAGAGAATACTTTCCGGATCCTCTAGTCTGGATCCTCTAGTCTTCAAGCCGGAAGGATATGAAAACCACCTCGAATACCGAATACCCCACCTTTAGCATATATTTATTCCGTTTAGTTCAGGGCCCAAGAGGGCAGAAATTCGCCAACCTTCAACTTATTAGTAAGGTCATTCGGCATTATTACGAACTTCTACCGCTTGGTGCGGATCTTAAAGCTACGTACACATTCATTCATATTGAGTTCCTCTACGGGAGGGAAATAATGTTGGCCTCAAGCCAAAACTACTACTGCTAGTGCTACATA

Full Affymetrix probeset data:

Annotations for 1639170_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720