FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639171_at:

>probe:Drosophila_2:1639171_at:304:577; Interrogation_Position=117; Antisense; GGCGCTGCGCATCCTGAAAACAGTT
>probe:Drosophila_2:1639171_at:249:595; Interrogation_Position=173; Antisense; TGGGCGGCCAGCAAACACAGCAATT
>probe:Drosophila_2:1639171_at:692:245; Interrogation_Position=194; Antisense; AATTGATTCACACAACGCCGGCGTG
>probe:Drosophila_2:1639171_at:492:435; Interrogation_Position=303; Antisense; GAGGTGCATCCATGTCTACAACAAA
>probe:Drosophila_2:1639171_at:396:331; Interrogation_Position=329; Antisense; GCGGAGTCGGCTTCATTGGCGATAA
>probe:Drosophila_2:1639171_at:99:223; Interrogation_Position=385; Antisense; AAGGGCATTCTCGTGGGACTCAAGC
>probe:Drosophila_2:1639171_at:72:379; Interrogation_Position=417; Antisense; GAAGCCCAAACAGCCGAAATTCGAT
>probe:Drosophila_2:1639171_at:304:395; Interrogation_Position=432; Antisense; GAAATTCGATAGCAACAACCTGGTG
>probe:Drosophila_2:1639171_at:126:137; Interrogation_Position=464; Antisense; ACGACAATGGCAGTCCGCTGGGCAC
>probe:Drosophila_2:1639171_at:47:449; Interrogation_Position=513; Antisense; GATCCTGCGAACCATCCTCAAGGAG
>probe:Drosophila_2:1639171_at:645:1; Interrogation_Position=552; Antisense; AGGAGCCGATTACACCAAGGTTCTG
>probe:Drosophila_2:1639171_at:494:581; Interrogation_Position=575; Antisense; TGGCCATCGCCAGCAGATATGTTTA
>probe:Drosophila_2:1639171_at:475:95; Interrogation_Position=589; Antisense; AGATATGTTTAGGATCCTCCGGATC
>probe:Drosophila_2:1639171_at:653:445; Interrogation_Position=610; Antisense; GATCACGCCTTTCTGTTGCTAAATG

Paste this into a BLAST search page for me
GGCGCTGCGCATCCTGAAAACAGTTTGGGCGGCCAGCAAACACAGCAATTAATTGATTCACACAACGCCGGCGTGGAGGTGCATCCATGTCTACAACAAAGCGGAGTCGGCTTCATTGGCGATAAAAGGGCATTCTCGTGGGACTCAAGCGAAGCCCAAACAGCCGAAATTCGATGAAATTCGATAGCAACAACCTGGTGACGACAATGGCAGTCCGCTGGGCACGATCCTGCGAACCATCCTCAAGGAGAGGAGCCGATTACACCAAGGTTCTGTGGCCATCGCCAGCAGATATGTTTAAGATATGTTTAGGATCCTCCGGATCGATCACGCCTTTCTGTTGCTAAATG

Full Affymetrix probeset data:

Annotations for 1639171_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720