FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639174_at:

>probe:Drosophila_2:1639174_at:587:273; Interrogation_Position=293; Antisense; CATTATTCGGGCGTTGCGATTCTGG
>probe:Drosophila_2:1639174_at:203:327; Interrogation_Position=308; Antisense; GCGATTCTGGGTTCCGCAGACTAGA
>probe:Drosophila_2:1639174_at:484:627; Interrogation_Position=336; Antisense; TCCAGCGCCTAGTCGTTGGGTATAC
>probe:Drosophila_2:1639174_at:485:327; Interrogation_Position=364; Antisense; GCGATGTACAGAGCCGCGACACGCG
>probe:Drosophila_2:1639174_at:44:183; Interrogation_Position=423; Antisense; AAAAGTTGTGGCAGCAGCACTTGCA
>probe:Drosophila_2:1639174_at:138:345; Interrogation_Position=475; Antisense; GCAGCCGGAAGACCAAACGACCATT
>probe:Drosophila_2:1639174_at:355:609; Interrogation_Position=499; Antisense; TGAGCCGCCCTTTTAAGCCGTGTTA
>probe:Drosophila_2:1639174_at:332:125; Interrogation_Position=514; Antisense; AGCCGTGTTAGTAGACCGCGGTCGT
>probe:Drosophila_2:1639174_at:630:379; Interrogation_Position=545; Antisense; GAACGAAAACCGTCGCCAATCGAAT
>probe:Drosophila_2:1639174_at:308:395; Interrogation_Position=594; Antisense; GAAATTACCGCTAAAATCGTCGCAG
>probe:Drosophila_2:1639174_at:267:701; Interrogation_Position=657; Antisense; TTTTTTCCAGTGCTCGCGACGCGAA
>probe:Drosophila_2:1639174_at:361:325; Interrogation_Position=672; Antisense; GCGACGCGAACCAATTTGAAACCTA
>probe:Drosophila_2:1639174_at:593:111; Interrogation_Position=744; Antisense; AGCAAAAAGTCCTTCGGCGGAGCAA
>probe:Drosophila_2:1639174_at:35:575; Interrogation_Position=759; Antisense; GGCGGAGCAACTTGCCTACTTTGAG

Paste this into a BLAST search page for me
CATTATTCGGGCGTTGCGATTCTGGGCGATTCTGGGTTCCGCAGACTAGATCCAGCGCCTAGTCGTTGGGTATACGCGATGTACAGAGCCGCGACACGCGAAAAGTTGTGGCAGCAGCACTTGCAGCAGCCGGAAGACCAAACGACCATTTGAGCCGCCCTTTTAAGCCGTGTTAAGCCGTGTTAGTAGACCGCGGTCGTGAACGAAAACCGTCGCCAATCGAATGAAATTACCGCTAAAATCGTCGCAGTTTTTTCCAGTGCTCGCGACGCGAAGCGACGCGAACCAATTTGAAACCTAAGCAAAAAGTCCTTCGGCGGAGCAAGGCGGAGCAACTTGCCTACTTTGAG

Full Affymetrix probeset data:

Annotations for 1639174_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720