FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639176_at:

>probe:Drosophila_2:1639176_at:129:247; Interrogation_Position=136; Antisense; AATTCGATTCTGATTTTGGCGGCGG
>probe:Drosophila_2:1639176_at:53:381; Interrogation_Position=211; Antisense; GAACCACAAATTCTACGGCGGCAAC
>probe:Drosophila_2:1639176_at:637:19; Interrogation_Position=278; Antisense; ATTTGTTCTGCTGTTAATCCTCTGC
>probe:Drosophila_2:1639176_at:303:203; Interrogation_Position=318; Antisense; AACCATGGAAGCTGGGCATCGCAAT
>probe:Drosophila_2:1639176_at:497:181; Interrogation_Position=348; Antisense; AAAAAGCACAATTCCGGCTCGATCC
>probe:Drosophila_2:1639176_at:237:365; Interrogation_Position=387; Antisense; GAATTTAAGCGACCCTTTGGCATAC
>probe:Drosophila_2:1639176_at:214:691; Interrogation_Position=402; Antisense; TTTGGCATACTCTGCACATATCGCT
>probe:Drosophila_2:1639176_at:365:151; Interrogation_Position=417; Antisense; ACATATCGCTGCTTTCTCTGGTTTC
>probe:Drosophila_2:1639176_at:526:479; Interrogation_Position=437; Antisense; GTTTCCGCCAATTTATCCGTACTGT
>probe:Drosophila_2:1639176_at:590:363; Interrogation_Position=462; Antisense; GAATTCATATTCGATCTGCGCTTAT
>probe:Drosophila_2:1639176_at:574:555; Interrogation_Position=509; Antisense; GGACTGCTACGAGATTCGCTGCAAC
>probe:Drosophila_2:1639176_at:51:421; Interrogation_Position=534; Antisense; GAGACCTTCTCCTTTTTCGGCAAGG
>probe:Drosophila_2:1639176_at:527:131; Interrogation_Position=581; Antisense; ACCTGGAGGGTCAGTTGCTCAGCGT
>probe:Drosophila_2:1639176_at:383:263; Interrogation_Position=600; Antisense; CAGCGTGTGAGCAACTGACATTCCA

Paste this into a BLAST search page for me
AATTCGATTCTGATTTTGGCGGCGGGAACCACAAATTCTACGGCGGCAACATTTGTTCTGCTGTTAATCCTCTGCAACCATGGAAGCTGGGCATCGCAATAAAAAGCACAATTCCGGCTCGATCCGAATTTAAGCGACCCTTTGGCATACTTTGGCATACTCTGCACATATCGCTACATATCGCTGCTTTCTCTGGTTTCGTTTCCGCCAATTTATCCGTACTGTGAATTCATATTCGATCTGCGCTTATGGACTGCTACGAGATTCGCTGCAACGAGACCTTCTCCTTTTTCGGCAAGGACCTGGAGGGTCAGTTGCTCAGCGTCAGCGTGTGAGCAACTGACATTCCA

Full Affymetrix probeset data:

Annotations for 1639176_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720