FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639177_at:

>probe:Drosophila_2:1639177_at:274:473; Interrogation_Position=108; Antisense; GTTCAACGGCAGCATCTTCGGCAAA
>probe:Drosophila_2:1639177_at:151:141; Interrogation_Position=113; Antisense; ACGGCAGCATCTTCGGCAAACGCAA
>probe:Drosophila_2:1639177_at:41:359; Interrogation_Position=128; Antisense; GCAAACGCAACAGCCTAGACTACGA
>probe:Drosophila_2:1639177_at:37:69; Interrogation_Position=13; Antisense; ATGGCTCTTCGATTCACACTCACTC
>probe:Drosophila_2:1639177_at:26:189; Interrogation_Position=136; Antisense; AACAGCCTAGACTACGACAGCGCCA
>probe:Drosophila_2:1639177_at:169:323; Interrogation_Position=155; Antisense; GCGCCAAAATGAGCGCCGTTTGCGA
>probe:Drosophila_2:1639177_at:693:267; Interrogation_Position=186; Antisense; CATGGAGGCGTGTCCCATGTGGTTT
>probe:Drosophila_2:1639177_at:467:59; Interrogation_Position=202; Antisense; ATGTGGTTTCCCCAGAACGACAGCA
>probe:Drosophila_2:1639177_at:296:479; Interrogation_Position=207; Antisense; GTTTCCCCAGAACGACAGCAAATAG
>probe:Drosophila_2:1639177_at:208:643; Interrogation_Position=36; Antisense; TCTGCTCCTGGTCACGATCCTGGTC
>probe:Drosophila_2:1639177_at:561:45; Interrogation_Position=52; Antisense; ATCCTGGTCGCAGCCATACTTTTGG
>probe:Drosophila_2:1639177_at:46:29; Interrogation_Position=67; Antisense; ATACTTTTGGGCTCCAGTGAGGCAG
>probe:Drosophila_2:1639177_at:551:335; Interrogation_Position=77; Antisense; GCTCCAGTGAGGCAGCCTACAGGAA
>probe:Drosophila_2:1639177_at:170:657; Interrogation_Position=94; Antisense; TACAGGAAGCCTCCGTTCAACGGCA

Paste this into a BLAST search page for me
GTTCAACGGCAGCATCTTCGGCAAAACGGCAGCATCTTCGGCAAACGCAAGCAAACGCAACAGCCTAGACTACGAATGGCTCTTCGATTCACACTCACTCAACAGCCTAGACTACGACAGCGCCAGCGCCAAAATGAGCGCCGTTTGCGACATGGAGGCGTGTCCCATGTGGTTTATGTGGTTTCCCCAGAACGACAGCAGTTTCCCCAGAACGACAGCAAATAGTCTGCTCCTGGTCACGATCCTGGTCATCCTGGTCGCAGCCATACTTTTGGATACTTTTGGGCTCCAGTGAGGCAGGCTCCAGTGAGGCAGCCTACAGGAATACAGGAAGCCTCCGTTCAACGGCA

Full Affymetrix probeset data:

Annotations for 1639177_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720