FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639179_at:

>probe:Drosophila_2:1639179_at:502:205; Interrogation_Position=1646; Antisense; AAGCCCTCGGATGAAGTGCTCCTGA
>probe:Drosophila_2:1639179_at:62:553; Interrogation_Position=1673; Antisense; GGAGCCGGCGTCACATTGTACGAGT
>probe:Drosophila_2:1639179_at:1:725; Interrogation_Position=1729; Antisense; TTGCATTACGGCACGAGTGATCGAC
>probe:Drosophila_2:1639179_at:280:85; Interrogation_Position=1744; Antisense; AGTGATCGACCCCTTTACAGTGAAG
>probe:Drosophila_2:1639179_at:115:511; Interrogation_Position=1763; Antisense; GTGAAGCCCCTCGATGTCGGACTAA
>probe:Drosophila_2:1639179_at:323:499; Interrogation_Position=1778; Antisense; GTCGGACTAATCGTGAAGCATGGAA
>probe:Drosophila_2:1639179_at:621:115; Interrogation_Position=1803; Antisense; AGCTGTGTCGTGGAAGAATCGTCGT
>probe:Drosophila_2:1639179_at:227:643; Interrogation_Position=1837; Antisense; TCATTACCAGCAAGGCGGATTGGGC
>probe:Drosophila_2:1639179_at:719:85; Interrogation_Position=1874; Antisense; AGTGCTCTGGCCGACTATCGAAACT
>probe:Drosophila_2:1639179_at:180:391; Interrogation_Position=1893; Antisense; GAAACTTTGTGGTCAAGCATCTCTA
>probe:Drosophila_2:1639179_at:102:117; Interrogation_Position=1908; Antisense; AGCATCTCTATATTACCACTGTACC
>probe:Drosophila_2:1639179_at:183:15; Interrogation_Position=1919; Antisense; ATTACCACTGTACCGAGATCAGGCC
>probe:Drosophila_2:1639179_at:272:631; Interrogation_Position=1945; Antisense; TCCTGCTGTTCTGCTGGACATGTTT
>probe:Drosophila_2:1639179_at:601:109; Interrogation_Position=1996; Antisense; AGCAAGCCTGGCCATCATGAAGAAG

Paste this into a BLAST search page for me
AAGCCCTCGGATGAAGTGCTCCTGAGGAGCCGGCGTCACATTGTACGAGTTTGCATTACGGCACGAGTGATCGACAGTGATCGACCCCTTTACAGTGAAGGTGAAGCCCCTCGATGTCGGACTAAGTCGGACTAATCGTGAAGCATGGAAAGCTGTGTCGTGGAAGAATCGTCGTTCATTACCAGCAAGGCGGATTGGGCAGTGCTCTGGCCGACTATCGAAACTGAAACTTTGTGGTCAAGCATCTCTAAGCATCTCTATATTACCACTGTACCATTACCACTGTACCGAGATCAGGCCTCCTGCTGTTCTGCTGGACATGTTTAGCAAGCCTGGCCATCATGAAGAAG

Full Affymetrix probeset data:

Annotations for 1639179_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720