Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639180_at:

>probe:Drosophila_2:1639180_at:312:357; Interrogation_Position=1833; Antisense; GCAAAACCTAAATTTCTTCGGAGAT
>probe:Drosophila_2:1639180_at:147:181; Interrogation_Position=1891; Antisense; AAACAATTCGAACCCACATAGCACT
>probe:Drosophila_2:1639180_at:243:661; Interrogation_Position=1924; Antisense; TAACGATTCGCCATCCGTGCGGTTG
>probe:Drosophila_2:1639180_at:152:135; Interrogation_Position=1951; Antisense; ACGCCAAAACTGTCTCTTCGAGATC
>probe:Drosophila_2:1639180_at:578:285; Interrogation_Position=1977; Antisense; CGGGCCTAGGGCTGTTTAACATTCG
>probe:Drosophila_2:1639180_at:266:661; Interrogation_Position=1993; Antisense; TAACATTCGACCCAAGCGATTTCGC
>probe:Drosophila_2:1639180_at:309:121; Interrogation_Position=2007; Antisense; AGCGATTTCGCGACAGGCTTCGGCA
>probe:Drosophila_2:1639180_at:233:717; Interrogation_Position=2025; Antisense; TTCGGCACGCCAGTATATAACCCAA
>probe:Drosophila_2:1639180_at:607:181; Interrogation_Position=2132; Antisense; AAAACCGGCCGCTTGTGCAGATGAC
>probe:Drosophila_2:1639180_at:413:617; Interrogation_Position=2147; Antisense; TGCAGATGACATAGGCGCGACCAGC
>probe:Drosophila_2:1639180_at:709:291; Interrogation_Position=2200; Antisense; CGTGCGCCATCAACTGGAATCTTGG
>probe:Drosophila_2:1639180_at:169:367; Interrogation_Position=2216; Antisense; GAATCTTGGCCACAAGCACAGCAAT
>probe:Drosophila_2:1639180_at:545:355; Interrogation_Position=2231; Antisense; GCACAGCAATAGTTTGGCCCGCTAT
>probe:Drosophila_2:1639180_at:28:161; Interrogation_Position=2295; Antisense; ACAAGTGGTTGCGTGGAACTGCTAA

Paste this into a BLAST search page for me
GCAAAACCTAAATTTCTTCGGAGATAAACAATTCGAACCCACATAGCACTTAACGATTCGCCATCCGTGCGGTTGACGCCAAAACTGTCTCTTCGAGATCCGGGCCTAGGGCTGTTTAACATTCGTAACATTCGACCCAAGCGATTTCGCAGCGATTTCGCGACAGGCTTCGGCATTCGGCACGCCAGTATATAACCCAAAAAACCGGCCGCTTGTGCAGATGACTGCAGATGACATAGGCGCGACCAGCCGTGCGCCATCAACTGGAATCTTGGGAATCTTGGCCACAAGCACAGCAATGCACAGCAATAGTTTGGCCCGCTATACAAGTGGTTGCGTGGAACTGCTAA

Full Affymetrix probeset data:

Annotations for 1639180_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime