FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639181_at:

>probe:Drosophila_2:1639181_at:269:201; Interrogation_Position=1006; Antisense; AACGCCATCTGTTGCTACTTCGTTA
>probe:Drosophila_2:1639181_at:549:327; Interrogation_Position=1019; Antisense; GCTACTTCGTTATGTGAGGTTATCT
>probe:Drosophila_2:1639181_at:650:557; Interrogation_Position=1121; Antisense; GGAAATTCATACACCCTTCTTAGCG
>probe:Drosophila_2:1639181_at:537:133; Interrogation_Position=1133; Antisense; ACCCTTCTTAGCGACCAATGGATAG
>probe:Drosophila_2:1639181_at:327:455; Interrogation_Position=1153; Antisense; GATAGCGTTTTACCTTTTCCAGAGC
>probe:Drosophila_2:1639181_at:336:693; Interrogation_Position=1168; Antisense; TTTCCAGAGCTTCATCGGCATGTTT
>probe:Drosophila_2:1639181_at:206:131; Interrogation_Position=655; Antisense; ACCCGTGCTTCTGGTTTCGGAAGTG
>probe:Drosophila_2:1639181_at:400:561; Interrogation_Position=673; Antisense; GGAAGTGGATTCCAGTCCCGTTTCT
>probe:Drosophila_2:1639181_at:432:695; Interrogation_Position=693; Antisense; TTTCTCAAACTACTTCCTCACCAGT
>probe:Drosophila_2:1639181_at:598:699; Interrogation_Position=759; Antisense; TTTTCCACGCTTCGTCAGACTGTAG
>probe:Drosophila_2:1639181_at:320:717; Interrogation_Position=769; Antisense; TTCGTCAGACTGTAGGAATCCATTT
>probe:Drosophila_2:1639181_at:242:455; Interrogation_Position=804; Antisense; GATAAGCACCATTCAAAGGCCGACT
>probe:Drosophila_2:1639181_at:652:615; Interrogation_Position=973; Antisense; TGCACAAAAGTGACCATTTCGAATC
>probe:Drosophila_2:1639181_at:171:695; Interrogation_Position=989; Antisense; TTTCGAATCATAGAGGCAACGCCAT

Paste this into a BLAST search page for me
AACGCCATCTGTTGCTACTTCGTTAGCTACTTCGTTATGTGAGGTTATCTGGAAATTCATACACCCTTCTTAGCGACCCTTCTTAGCGACCAATGGATAGGATAGCGTTTTACCTTTTCCAGAGCTTTCCAGAGCTTCATCGGCATGTTTACCCGTGCTTCTGGTTTCGGAAGTGGGAAGTGGATTCCAGTCCCGTTTCTTTTCTCAAACTACTTCCTCACCAGTTTTTCCACGCTTCGTCAGACTGTAGTTCGTCAGACTGTAGGAATCCATTTGATAAGCACCATTCAAAGGCCGACTTGCACAAAAGTGACCATTTCGAATCTTTCGAATCATAGAGGCAACGCCAT

Full Affymetrix probeset data:

Annotations for 1639181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720