FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639182_at:

>probe:Drosophila_2:1639182_at:522:675; Interrogation_Position=1010; Antisense; TAGCGCCAATACACCTCCAGAAATA
>probe:Drosophila_2:1639182_at:311:71; Interrogation_Position=1085; Antisense; AGGCGACTCTCCTAGTATTTGGAAC
>probe:Drosophila_2:1639182_at:426:163; Interrogation_Position=1118; Antisense; AAATATCATACCCACAGCTCATTGC
>probe:Drosophila_2:1639182_at:272:719; Interrogation_Position=1139; Antisense; TTGCTCGCCCACAATATCAATTAGT
>probe:Drosophila_2:1639182_at:27:87; Interrogation_Position=1161; Antisense; AGTCCTACCGACTCACTGTTAGGTA
>probe:Drosophila_2:1639182_at:486:171; Interrogation_Position=1227; Antisense; AAAGAGCCCATTATGCCTAATCTCC
>probe:Drosophila_2:1639182_at:156:349; Interrogation_Position=1287; Antisense; GCAGACAATTTTTTAACTCATCGAG
>probe:Drosophila_2:1639182_at:325:387; Interrogation_Position=1329; Antisense; GAAAATACTGTTACCACTGCTTTGG
>probe:Drosophila_2:1639182_at:224:145; Interrogation_Position=1344; Antisense; ACTGCTTTGGTTCCGTGTGGTCACA
>probe:Drosophila_2:1639182_at:362:681; Interrogation_Position=1379; Antisense; TATGGAGTGCGCCAATCACATCTGT
>probe:Drosophila_2:1639182_at:507:347; Interrogation_Position=1416; Antisense; GCAGTTTGTCCGGTTTGTAATTCTA
>probe:Drosophila_2:1639182_at:641:661; Interrogation_Position=884; Antisense; TAAAACATTGTCTTTCTGTCCTCCC
>probe:Drosophila_2:1639182_at:360:289; Interrogation_Position=919; Antisense; CGGCATCGTTTCATTCCAACTGTAA
>probe:Drosophila_2:1639182_at:687:185; Interrogation_Position=956; Antisense; AACAAGATCTTGTTCATCCGCTTCT

Paste this into a BLAST search page for me
TAGCGCCAATACACCTCCAGAAATAAGGCGACTCTCCTAGTATTTGGAACAAATATCATACCCACAGCTCATTGCTTGCTCGCCCACAATATCAATTAGTAGTCCTACCGACTCACTGTTAGGTAAAAGAGCCCATTATGCCTAATCTCCGCAGACAATTTTTTAACTCATCGAGGAAAATACTGTTACCACTGCTTTGGACTGCTTTGGTTCCGTGTGGTCACATATGGAGTGCGCCAATCACATCTGTGCAGTTTGTCCGGTTTGTAATTCTATAAAACATTGTCTTTCTGTCCTCCCCGGCATCGTTTCATTCCAACTGTAAAACAAGATCTTGTTCATCCGCTTCT

Full Affymetrix probeset data:

Annotations for 1639182_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720