FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639184_at:

>probe:Drosophila_2:1639184_at:400:415; Interrogation_Position=484; Antisense; GAGCCTACGAGGTTCTGAGGACCAC
>probe:Drosophila_2:1639184_at:627:607; Interrogation_Position=499; Antisense; TGAGGACCACGCTACCAAAGCTGTT
>probe:Drosophila_2:1639184_at:631:173; Interrogation_Position=515; Antisense; AAAGCTGTTCGTGGAGCCCCTAGAC
>probe:Drosophila_2:1639184_at:495:677; Interrogation_Position=535; Antisense; TAGACTACTCCATTTACAGCCCGGG
>probe:Drosophila_2:1639184_at:489:615; Interrogation_Position=580; Antisense; TAACGGGCAAGCACACGGTGGGCCT
>probe:Drosophila_2:1639184_at:517:531; Interrogation_Position=596; Antisense; GGTGGGCCTGTACCACTACGTCAAA
>probe:Drosophila_2:1639184_at:34:373; Interrogation_Position=637; Antisense; GAACGGTTGGCCACCTGAAGTACGC
>probe:Drosophila_2:1639184_at:436:129; Interrogation_Position=697; Antisense; ACCAGGACGACTACACAGTGCGGAT
>probe:Drosophila_2:1639184_at:644:577; Interrogation_Position=747; Antisense; GGCCTGAAGGTCATGTTCCAGTTCT
>probe:Drosophila_2:1639184_at:431:93; Interrogation_Position=766; Antisense; AGTTCTGGAAGTACAAGCTCTGGCA
>probe:Drosophila_2:1639184_at:673:33; Interrogation_Position=811; Antisense; ATCAGGAGGCCTGGTACGACGGCTA
>probe:Drosophila_2:1639184_at:31:147; Interrogation_Position=835; Antisense; ACTCTGTCTGCTATCTGGGCGACGA
>probe:Drosophila_2:1639184_at:643:63; Interrogation_Position=859; Antisense; ATGGGCTGATCGTCAAGCACGTCGT
>probe:Drosophila_2:1639184_at:553:437; Interrogation_Position=912; Antisense; GAGGCGGTTGAGAACCCTTCTGCGA

Paste this into a BLAST search page for me
GAGCCTACGAGGTTCTGAGGACCACTGAGGACCACGCTACCAAAGCTGTTAAAGCTGTTCGTGGAGCCCCTAGACTAGACTACTCCATTTACAGCCCGGGTAACGGGCAAGCACACGGTGGGCCTGGTGGGCCTGTACCACTACGTCAAAGAACGGTTGGCCACCTGAAGTACGCACCAGGACGACTACACAGTGCGGATGGCCTGAAGGTCATGTTCCAGTTCTAGTTCTGGAAGTACAAGCTCTGGCAATCAGGAGGCCTGGTACGACGGCTAACTCTGTCTGCTATCTGGGCGACGAATGGGCTGATCGTCAAGCACGTCGTGAGGCGGTTGAGAACCCTTCTGCGA

Full Affymetrix probeset data:

Annotations for 1639184_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720