FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639185_at:

>probe:Drosophila_2:1639185_at:442:235; Interrogation_Position=2491; Antisense; AATCGCTGAAATCCGAGGACGAGAC
>probe:Drosophila_2:1639185_at:446:75; Interrogation_Position=2506; Antisense; AGGACGAGACCGATGAGGACCATGT
>probe:Drosophila_2:1639185_at:29:553; Interrogation_Position=2522; Antisense; GGACCATGTGCAGGATCACAAGCAT
>probe:Drosophila_2:1639185_at:644:319; Interrogation_Position=2565; Antisense; GCCGCAGATACCTCCAAGACAAAAG
>probe:Drosophila_2:1639185_at:106:395; Interrogation_Position=2591; Antisense; GAAAGGCAGTCCAAAGCAGGTTGAA
>probe:Drosophila_2:1639185_at:466:587; Interrogation_Position=2644; Antisense; TGGACCACAGTAGCCATCCCATGGA
>probe:Drosophila_2:1639185_at:310:271; Interrogation_Position=2658; Antisense; CATCCCATGGACACAGACACAGAGA
>probe:Drosophila_2:1639185_at:9:269; Interrogation_Position=2719; Antisense; CAGGGTATGCGAGCCAGCAGCGACA
>probe:Drosophila_2:1639185_at:712:395; Interrogation_Position=2740; Antisense; GACAAGACGAGGATCAGGACACCGA
>probe:Drosophila_2:1639185_at:254:549; Interrogation_Position=2909; Antisense; GGAGGAGCAGTCACTCAATCCGGCT
>probe:Drosophila_2:1639185_at:433:235; Interrogation_Position=2925; Antisense; AATCCGGCTGTGACCGAGGACACGC
>probe:Drosophila_2:1639185_at:101:439; Interrogation_Position=2940; Antisense; GAGGACACGCAGATCACCATTGAGT
>probe:Drosophila_2:1639185_at:40:55; Interrogation_Position=2980; Antisense; ATGAGGAGTTTCAATCGGCCGCCGA
>probe:Drosophila_2:1639185_at:237:75; Interrogation_Position=3013; Antisense; AGGACGACATGGTCGGCCTGATCAT

Paste this into a BLAST search page for me
AATCGCTGAAATCCGAGGACGAGACAGGACGAGACCGATGAGGACCATGTGGACCATGTGCAGGATCACAAGCATGCCGCAGATACCTCCAAGACAAAAGGAAAGGCAGTCCAAAGCAGGTTGAATGGACCACAGTAGCCATCCCATGGACATCCCATGGACACAGACACAGAGACAGGGTATGCGAGCCAGCAGCGACAGACAAGACGAGGATCAGGACACCGAGGAGGAGCAGTCACTCAATCCGGCTAATCCGGCTGTGACCGAGGACACGCGAGGACACGCAGATCACCATTGAGTATGAGGAGTTTCAATCGGCCGCCGAAGGACGACATGGTCGGCCTGATCAT

Full Affymetrix probeset data:

Annotations for 1639185_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720