Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639186_at:

>probe:Drosophila_2:1639186_at:132:281; Interrogation_Position=4343; Antisense; CTGTGTTCAAACTTTTTCGACGAAT
>probe:Drosophila_2:1639186_at:580:471; Interrogation_Position=4391; Antisense; GTTCGATGTCAATCCTGCAGCAGAT
>probe:Drosophila_2:1639186_at:317:387; Interrogation_Position=4428; Antisense; GAACACAAAACCCAGCATACATACC
>probe:Drosophila_2:1639186_at:82:27; Interrogation_Position=4448; Antisense; ATACCCGCGTAATTGTCTATGGATA
>probe:Drosophila_2:1639186_at:500:653; Interrogation_Position=4556; Antisense; TCAATTTTTGCGCAAGCCAGCAACT
>probe:Drosophila_2:1639186_at:40:313; Interrogation_Position=4571; Antisense; GCCAGCAACTTATACTTATACGGAT
>probe:Drosophila_2:1639186_at:443:459; Interrogation_Position=4593; Antisense; GATATATAGACGTCTCCTTAGCGCC
>probe:Drosophila_2:1639186_at:195:643; Interrogation_Position=4605; Antisense; TCTCCTTAGCGCCTTTGCCAAGTTG
>probe:Drosophila_2:1639186_at:446:311; Interrogation_Position=4621; Antisense; GCCAAGTTGCCTAACTGAGTTCACT
>probe:Drosophila_2:1639186_at:206:285; Interrogation_Position=4635; Antisense; CTGAGTTCACTCTCATTCTGAAAAT
>probe:Drosophila_2:1639186_at:329:387; Interrogation_Position=4654; Antisense; GAAAATCTTTGTTCTCGGTTGAAGT
>probe:Drosophila_2:1639186_at:142:655; Interrogation_Position=4693; Antisense; TAACCGTTTCGTTAGCCGATTCGAT
>probe:Drosophila_2:1639186_at:335:463; Interrogation_Position=4710; Antisense; GATTCGATTCGTTTTCCAGTGAGTA
>probe:Drosophila_2:1639186_at:549:687; Interrogation_Position=4757; Antisense; TTTGTTGAACGTTTCCATTTAGCAC

Paste this into a BLAST search page for me
CTGTGTTCAAACTTTTTCGACGAATGTTCGATGTCAATCCTGCAGCAGATGAACACAAAACCCAGCATACATACCATACCCGCGTAATTGTCTATGGATATCAATTTTTGCGCAAGCCAGCAACTGCCAGCAACTTATACTTATACGGATGATATATAGACGTCTCCTTAGCGCCTCTCCTTAGCGCCTTTGCCAAGTTGGCCAAGTTGCCTAACTGAGTTCACTCTGAGTTCACTCTCATTCTGAAAATGAAAATCTTTGTTCTCGGTTGAAGTTAACCGTTTCGTTAGCCGATTCGATGATTCGATTCGTTTTCCAGTGAGTATTTGTTGAACGTTTCCATTTAGCAC

Full Affymetrix probeset data:

Annotations for 1639186_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime