FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639188_at:

>probe:Drosophila_2:1639188_at:331:657; Interrogation_Position=1712; Antisense; TAAGTGCTGCAGCTTGTCTTTTGTT
>probe:Drosophila_2:1639188_at:17:677; Interrogation_Position=1772; Antisense; TAGTTTGTGTCTCTGTTAGCCTGTA
>probe:Drosophila_2:1639188_at:114:475; Interrogation_Position=1786; Antisense; GTTAGCCTGTAGTCGTACTTTTGTA
>probe:Drosophila_2:1639188_at:320:17; Interrogation_Position=1814; Antisense; ATTTATTCTTGTTGCGACGATGACG
>probe:Drosophila_2:1639188_at:672:683; Interrogation_Position=1945; Antisense; TATCGTGCGCCTATACAAACTATAT
>probe:Drosophila_2:1639188_at:24:467; Interrogation_Position=2000; Antisense; GTTGTACTGAACTGATCGACCCGCG
>probe:Drosophila_2:1639188_at:342:449; Interrogation_Position=2013; Antisense; GATCGACCCGCGGAGGTTGCATAAA
>probe:Drosophila_2:1639188_at:279:31; Interrogation_Position=2033; Antisense; ATAAAATCCGCTTTGTGCCCATTGT
>probe:Drosophila_2:1639188_at:42:107; Interrogation_Position=2066; Antisense; AGACACACACTATTTTCCATTTGAA
>probe:Drosophila_2:1639188_at:77:125; Interrogation_Position=2121; Antisense; AGCCCCTTTTAGACGTCATTACGTG
>probe:Drosophila_2:1639188_at:393:481; Interrogation_Position=2145; Antisense; GTATTTTTGGTTGGTTAGCACACTT
>probe:Drosophila_2:1639188_at:645:665; Interrogation_Position=2185; Antisense; TACTCAAGTCCTCAAATTGCTCCAG
>probe:Drosophila_2:1639188_at:308:337; Interrogation_Position=2203; Antisense; GCTCCAGCTGGTGCAAATTGTCCCA
>probe:Drosophila_2:1639188_at:197:599; Interrogation_Position=2221; Antisense; TGTCCCACCAGAGTTTCAATCGATG

Paste this into a BLAST search page for me
TAAGTGCTGCAGCTTGTCTTTTGTTTAGTTTGTGTCTCTGTTAGCCTGTAGTTAGCCTGTAGTCGTACTTTTGTAATTTATTCTTGTTGCGACGATGACGTATCGTGCGCCTATACAAACTATATGTTGTACTGAACTGATCGACCCGCGGATCGACCCGCGGAGGTTGCATAAAATAAAATCCGCTTTGTGCCCATTGTAGACACACACTATTTTCCATTTGAAAGCCCCTTTTAGACGTCATTACGTGGTATTTTTGGTTGGTTAGCACACTTTACTCAAGTCCTCAAATTGCTCCAGGCTCCAGCTGGTGCAAATTGTCCCATGTCCCACCAGAGTTTCAATCGATG

Full Affymetrix probeset data:

Annotations for 1639188_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720