Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639189_at:

>probe:Drosophila_2:1639189_at:514:507; Interrogation_Position=3584; Antisense; GTGCAATTAGCGTCGATTATAGGTA
>probe:Drosophila_2:1639189_at:562:355; Interrogation_Position=3618; Antisense; GCACTCATTATATATACTCGCGATA
>probe:Drosophila_2:1639189_at:328:163; Interrogation_Position=3650; Antisense; AAATTACCTTCAACTAGCGCCTATT
>probe:Drosophila_2:1639189_at:699:673; Interrogation_Position=3664; Antisense; TAGCGCCTATTTTACGCCCAGCGTT
>probe:Drosophila_2:1639189_at:110:263; Interrogation_Position=3682; Antisense; CAGCGTTGTTCAAATTTGTTCCCAA
>probe:Drosophila_2:1639189_at:487:681; Interrogation_Position=3767; Antisense; TATGGTGCAGCAATACAAATTCTAT
>probe:Drosophila_2:1639189_at:166:5; Interrogation_Position=3831; Antisense; ATTGTCCAATCGATCGAAGTGTCAA
>probe:Drosophila_2:1639189_at:246:535; Interrogation_Position=3870; Antisense; GGTGAACTGTTAGCACAAACTGAAT
>probe:Drosophila_2:1639189_at:481:193; Interrogation_Position=3887; Antisense; AACTGAATTCTCACGCTATTGGCAT
>probe:Drosophila_2:1639189_at:160:135; Interrogation_Position=3899; Antisense; ACGCTATTGGCATTGTGATCAGTAT
>probe:Drosophila_2:1639189_at:258:703; Interrogation_Position=4024; Antisense; TTATTGAAGAACACACGCCCACACA
>probe:Drosophila_2:1639189_at:537:209; Interrogation_Position=4090; Antisense; AAGCAAGCGCACACATTTTGCCAAT
>probe:Drosophila_2:1639189_at:14:213; Interrogation_Position=4127; Antisense; AAGAGCGTTACCACAAATCACTGAA
>probe:Drosophila_2:1639189_at:225:255; Interrogation_Position=4155; Antisense; CAACATTCACTTTGTCATTTCGCCA

Paste this into a BLAST search page for me
GTGCAATTAGCGTCGATTATAGGTAGCACTCATTATATATACTCGCGATAAAATTACCTTCAACTAGCGCCTATTTAGCGCCTATTTTACGCCCAGCGTTCAGCGTTGTTCAAATTTGTTCCCAATATGGTGCAGCAATACAAATTCTATATTGTCCAATCGATCGAAGTGTCAAGGTGAACTGTTAGCACAAACTGAATAACTGAATTCTCACGCTATTGGCATACGCTATTGGCATTGTGATCAGTATTTATTGAAGAACACACGCCCACACAAAGCAAGCGCACACATTTTGCCAATAAGAGCGTTACCACAAATCACTGAACAACATTCACTTTGTCATTTCGCCA

Full Affymetrix probeset data:

Annotations for 1639189_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime