Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639191_at:

>probe:Drosophila_2:1639191_at:657:87; Interrogation_Position=1041; Antisense; AGTCACGGCCCGATTGATCAGTAAT
>probe:Drosophila_2:1639191_at:323:545; Interrogation_Position=1105; Antisense; GGATCCGTGGATAGTGGCCTAATAC
>probe:Drosophila_2:1639191_at:226:293; Interrogation_Position=1149; Antisense; CGATGCATCCTTGGCGGGAACCATA
>probe:Drosophila_2:1639191_at:431:7; Interrogation_Position=1189; Antisense; ATTGCTGGTTCCAATTTGGTGTCCA
>probe:Drosophila_2:1639191_at:517:181; Interrogation_Position=1300; Antisense; AAAACCGGAGACATTTGCGCCTATC
>probe:Drosophila_2:1639191_at:565:173; Interrogation_Position=1352; Antisense; AAAGCAGCGATATCTTCACCGTCGG
>probe:Drosophila_2:1639191_at:696:223; Interrogation_Position=1408; Antisense; AAGGTATTGATCTCACATCCGAATA
>probe:Drosophila_2:1639191_at:179:573; Interrogation_Position=1443; Antisense; GGCTGTCTTAGGTATTCCCAATAAA
>probe:Drosophila_2:1639191_at:461:521; Interrogation_Position=1473; Antisense; GGGCCATCGTCTTGGTGTCATATGC
>probe:Drosophila_2:1639191_at:178:599; Interrogation_Position=1488; Antisense; TGTCATATGCATTGTATCCCCGGAT
>probe:Drosophila_2:1639191_at:483:301; Interrogation_Position=1505; Antisense; CCCCGGATGCGGATATTGATTTGGA
>probe:Drosophila_2:1639191_at:474:453; Interrogation_Position=1533; Antisense; GATCAAGACATACTGCTATCGCCAC
>probe:Drosophila_2:1639191_at:690:257; Interrogation_Position=1567; Antisense; CACAAATGCCCTACCGTTTTCAAGA
>probe:Drosophila_2:1639191_at:143:689; Interrogation_Position=1584; Antisense; TTTCAAGACCCTCGTTTCCAAGTAG

Paste this into a BLAST search page for me
AGTCACGGCCCGATTGATCAGTAATGGATCCGTGGATAGTGGCCTAATACCGATGCATCCTTGGCGGGAACCATAATTGCTGGTTCCAATTTGGTGTCCAAAAACCGGAGACATTTGCGCCTATCAAAGCAGCGATATCTTCACCGTCGGAAGGTATTGATCTCACATCCGAATAGGCTGTCTTAGGTATTCCCAATAAAGGGCCATCGTCTTGGTGTCATATGCTGTCATATGCATTGTATCCCCGGATCCCCGGATGCGGATATTGATTTGGAGATCAAGACATACTGCTATCGCCACCACAAATGCCCTACCGTTTTCAAGATTTCAAGACCCTCGTTTCCAAGTAG

Full Affymetrix probeset data:

Annotations for 1639191_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime