FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639192_at:

>probe:Drosophila_2:1639192_at:274:85; Interrogation_Position=1016; Antisense; AGTGCTTCGTCTCCATACTGAACAT
>probe:Drosophila_2:1639192_at:721:519; Interrogation_Position=1054; Antisense; GTGGATCCATCCCAGGTGCACAAGT
>probe:Drosophila_2:1639192_at:340:85; Interrogation_Position=1175; Antisense; AGTCGGCCCACAAGGTATCCGGATT
>probe:Drosophila_2:1639192_at:181:445; Interrogation_Position=1200; Antisense; GATGATGGCCAATCACACGGGTATC
>probe:Drosophila_2:1639192_at:290:141; Interrogation_Position=1216; Antisense; ACGGGTATCAGTTCGCTCTTCAAGA
>probe:Drosophila_2:1639192_at:90:81; Interrogation_Position=1240; Antisense; AGGGCCTTGGCCCAGTACGATAAGC
>probe:Drosophila_2:1639192_at:308:365; Interrogation_Position=1303; Antisense; GAATCCATGTTCCAGGACGACCTGA
>probe:Drosophila_2:1639192_at:515:71; Interrogation_Position=1316; Antisense; AGGACGACCTGACCGAACTGGACAT
>probe:Drosophila_2:1639192_at:452:259; Interrogation_Position=1343; Antisense; CACGGGACACGGTTGACTGCTTGGT
>probe:Drosophila_2:1639192_at:367:57; Interrogation_Position=1376; Antisense; ATGAGGCAGCCACCCAGATCGATTA
>probe:Drosophila_2:1639192_at:133:43; Interrogation_Position=1393; Antisense; ATCGATTATCCCCAGTGGAGTCCTG
>probe:Drosophila_2:1639192_at:675:547; Interrogation_Position=1409; Antisense; GGAGTCCTGCTGTCGAAGCTTCGAA
>probe:Drosophila_2:1639192_at:502:475; Interrogation_Position=940; Antisense; GTTTTGGATGTAATGCGTCGCCTTC
>probe:Drosophila_2:1639192_at:537:107; Interrogation_Position=974; Antisense; AGAACATGATGGTTTCCGCGCTGAC

Paste this into a BLAST search page for me
AGTGCTTCGTCTCCATACTGAACATGTGGATCCATCCCAGGTGCACAAGTAGTCGGCCCACAAGGTATCCGGATTGATGATGGCCAATCACACGGGTATCACGGGTATCAGTTCGCTCTTCAAGAAGGGCCTTGGCCCAGTACGATAAGCGAATCCATGTTCCAGGACGACCTGAAGGACGACCTGACCGAACTGGACATCACGGGACACGGTTGACTGCTTGGTATGAGGCAGCCACCCAGATCGATTAATCGATTATCCCCAGTGGAGTCCTGGGAGTCCTGCTGTCGAAGCTTCGAAGTTTTGGATGTAATGCGTCGCCTTCAGAACATGATGGTTTCCGCGCTGAC

Full Affymetrix probeset data:

Annotations for 1639192_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720