Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639193_a_at:

>probe:Drosophila_2:1639193_a_at:553:567; Interrogation_Position=1118; Antisense; GGCACTATAATAATACCTCTTCAAA
>probe:Drosophila_2:1639193_a_at:638:583; Interrogation_Position=575; Antisense; TGGAGAAGGTTCTCGGCTTTCTAGA
>probe:Drosophila_2:1639193_a_at:572:465; Interrogation_Position=603; Antisense; GATTGGCAGCGAATCTTCACGGCCG
>probe:Drosophila_2:1639193_a_at:212:579; Interrogation_Position=623; Antisense; GGCCGTCTCCACAAGGAAGTCAGCT
>probe:Drosophila_2:1639193_a_at:516:371; Interrogation_Position=638; Antisense; GAAGTCAGCTCTTTGGGTGTCCCAG
>probe:Drosophila_2:1639193_a_at:586:323; Interrogation_Position=678; Antisense; GCGCGAGAAGATCGAAGCATTCAAC
>probe:Drosophila_2:1639193_a_at:167:651; Interrogation_Position=698; Antisense; TCAACAAGGTCTTAGAGGCGGCCCC
>probe:Drosophila_2:1639193_a_at:106:525; Interrogation_Position=734; Antisense; GGGATACCTGCCGTCATTTTAAGGA
>probe:Drosophila_2:1639193_a_at:261:225; Interrogation_Position=754; Antisense; AAGGAGTGCTTTTGTAGCTGCTGCA
>probe:Drosophila_2:1639193_a_at:542:485; Interrogation_Position=767; Antisense; GTAGCTGCTGCACCTTGGACGAGTC
>probe:Drosophila_2:1639193_a_at:380:431; Interrogation_Position=787; Antisense; GAGTCCTTCCTGTCTAAAGGGCACA
>probe:Drosophila_2:1639193_a_at:708:467; Interrogation_Position=823; Antisense; GTTGCCTCGAAAACAAATTCGGGCT
>probe:Drosophila_2:1639193_a_at:29:355; Interrogation_Position=876; Antisense; GCAGCCGGAGCGGTCCAATAACGAA
>probe:Drosophila_2:1639193_a_at:170:547; Interrogation_Position=991; Antisense; GGAGTATCTTTTCAATGCCTAGTAA

Paste this into a BLAST search page for me
GGCACTATAATAATACCTCTTCAAATGGAGAAGGTTCTCGGCTTTCTAGAGATTGGCAGCGAATCTTCACGGCCGGGCCGTCTCCACAAGGAAGTCAGCTGAAGTCAGCTCTTTGGGTGTCCCAGGCGCGAGAAGATCGAAGCATTCAACTCAACAAGGTCTTAGAGGCGGCCCCGGGATACCTGCCGTCATTTTAAGGAAAGGAGTGCTTTTGTAGCTGCTGCAGTAGCTGCTGCACCTTGGACGAGTCGAGTCCTTCCTGTCTAAAGGGCACAGTTGCCTCGAAAACAAATTCGGGCTGCAGCCGGAGCGGTCCAATAACGAAGGAGTATCTTTTCAATGCCTAGTAA

Full Affymetrix probeset data:

Annotations for 1639193_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime