FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639196_at:

>probe:Drosophila_2:1639196_at:203:269; Interrogation_Position=317; Antisense; CATCTACTACGGTGCTCTGTGGCGC
>probe:Drosophila_2:1639196_at:24:71; Interrogation_Position=346; Antisense; AGGCTCAGTACACCCACACCGTGGG
>probe:Drosophila_2:1639196_at:90:285; Interrogation_Position=414; Antisense; CTGAACAACGACATCTCGCTGATCA
>probe:Drosophila_2:1639196_at:46:567; Interrogation_Position=492; Antisense; GGCAACGAGCGCCACGACAGCTTTG
>probe:Drosophila_2:1639196_at:51:695; Interrogation_Position=513; Antisense; TTTGCCGGCTGGTGGGCTCTAGCCT
>probe:Drosophila_2:1639196_at:637:69; Interrogation_Position=549; Antisense; AGGCCTTGCGATAGCTGTGGCGTCT
>probe:Drosophila_2:1639196_at:520:595; Interrogation_Position=564; Antisense; TGTGGCGTCTCCGACTACCTGAACT
>probe:Drosophila_2:1639196_at:431:613; Interrogation_Position=583; Antisense; TGAACTGCGTGGACTCCCAGATCAT
>probe:Drosophila_2:1639196_at:366:409; Interrogation_Position=615; Antisense; GACGAGTGCTCCAGCGTCTATGGAA
>probe:Drosophila_2:1639196_at:170:337; Interrogation_Position=622; Antisense; GCTCCAGCGTCTATGGAACCGATGT
>probe:Drosophila_2:1639196_at:233:381; Interrogation_Position=637; Antisense; GAACCGATGTGATCACCGACAACGT
>probe:Drosophila_2:1639196_at:288:409; Interrogation_Position=732; Antisense; GACCGCTCCAAGCTGGTCGGTGTCA
>probe:Drosophila_2:1639196_at:145:271; Interrogation_Position=851; Antisense; CATCTCCTACTAATTTCGTTCTCGA
>probe:Drosophila_2:1639196_at:611:471; Interrogation_Position=868; Antisense; GTTCTCGAAATAAACCCTTCTGCAT

Paste this into a BLAST search page for me
CATCTACTACGGTGCTCTGTGGCGCAGGCTCAGTACACCCACACCGTGGGCTGAACAACGACATCTCGCTGATCAGGCAACGAGCGCCACGACAGCTTTGTTTGCCGGCTGGTGGGCTCTAGCCTAGGCCTTGCGATAGCTGTGGCGTCTTGTGGCGTCTCCGACTACCTGAACTTGAACTGCGTGGACTCCCAGATCATGACGAGTGCTCCAGCGTCTATGGAAGCTCCAGCGTCTATGGAACCGATGTGAACCGATGTGATCACCGACAACGTGACCGCTCCAAGCTGGTCGGTGTCACATCTCCTACTAATTTCGTTCTCGAGTTCTCGAAATAAACCCTTCTGCAT

Full Affymetrix probeset data:

Annotations for 1639196_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720