Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639197_at:

>probe:Drosophila_2:1639197_at:333:325; Interrogation_Position=1024; Antisense; GCGAGAGCAGGATTCCCAGGAGCCT
>probe:Drosophila_2:1639197_at:696:605; Interrogation_Position=1083; Antisense; TGATCGGCCGACTTATGTACTGCAT
>probe:Drosophila_2:1639197_at:172:489; Interrogation_Position=1099; Antisense; GTACTGCATGCACCTCGAGATCTGA
>probe:Drosophila_2:1639197_at:173:609; Interrogation_Position=555; Antisense; TGACCTCTGAAGCAGCGGCCGTAGA
>probe:Drosophila_2:1639197_at:445:677; Interrogation_Position=576; Antisense; TAGATCACGGATTCGCCCTGGGCGA
>probe:Drosophila_2:1639197_at:14:345; Interrogation_Position=607; Antisense; GCTTGTCCAGGACCACATCAATGTG
>probe:Drosophila_2:1639197_at:169:59; Interrogation_Position=638; Antisense; ATGATGCACCAGACGCCGCTAGAGG
>probe:Drosophila_2:1639197_at:680:677; Interrogation_Position=657; Antisense; TAGAGGGTCCCAGTGATCCGCGCTT
>probe:Drosophila_2:1639197_at:607:353; Interrogation_Position=684; Antisense; GCAGCCGCCGATTCTCGATGGTGAA
>probe:Drosophila_2:1639197_at:721:421; Interrogation_Position=731; Antisense; GAGAAGGCACTCGAGATTGGCAAGC
>probe:Drosophila_2:1639197_at:298:525; Interrogation_Position=760; Antisense; GGGCATCCAGAAGTTCCTGCACAGC
>probe:Drosophila_2:1639197_at:205:497; Interrogation_Position=788; Antisense; GTCTTAGCCTGCATGGGAGGTCCCA
>probe:Drosophila_2:1639197_at:457:591; Interrogation_Position=879; Antisense; TGGTGCCCGAGGTTATAGCCGCCCA
>probe:Drosophila_2:1639197_at:231:81; Interrogation_Position=918; Antisense; AGGTGCTCGCCTTTGTGGTTATCAG

Paste this into a BLAST search page for me
GCGAGAGCAGGATTCCCAGGAGCCTTGATCGGCCGACTTATGTACTGCATGTACTGCATGCACCTCGAGATCTGATGACCTCTGAAGCAGCGGCCGTAGATAGATCACGGATTCGCCCTGGGCGAGCTTGTCCAGGACCACATCAATGTGATGATGCACCAGACGCCGCTAGAGGTAGAGGGTCCCAGTGATCCGCGCTTGCAGCCGCCGATTCTCGATGGTGAAGAGAAGGCACTCGAGATTGGCAAGCGGGCATCCAGAAGTTCCTGCACAGCGTCTTAGCCTGCATGGGAGGTCCCATGGTGCCCGAGGTTATAGCCGCCCAAGGTGCTCGCCTTTGTGGTTATCAG

Full Affymetrix probeset data:

Annotations for 1639197_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime