FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639198_at:

>probe:Drosophila_2:1639198_at:2:215; Interrogation_Position=1072; Antisense; AAGAGTGACTTCAGCAAGGGCAAAC
>probe:Drosophila_2:1639198_at:664:179; Interrogation_Position=1093; Antisense; AAACAGTTCGGCATCTCTGGTCGCG
>probe:Drosophila_2:1639198_at:169:537; Interrogation_Position=1111; Antisense; GGTCGCGAAATGTTCAGCTTCAATC
>probe:Drosophila_2:1639198_at:301:343; Interrogation_Position=1127; Antisense; GCTTCAATCCGGATCTGGTCGACGA
>probe:Drosophila_2:1639198_at:146:603; Interrogation_Position=1176; Antisense; TGCTTTCGACGTCTACAACAGGGAG
>probe:Drosophila_2:1639198_at:159:455; Interrogation_Position=1210; Antisense; GATAATGCCGTCGAGTTCAAGGAAC
>probe:Drosophila_2:1639198_at:266:669; Interrogation_Position=1307; Antisense; TACTGGACCAGGCAACCGAAGCAGC
>probe:Drosophila_2:1639198_at:548:643; Interrogation_Position=1422; Antisense; TCTCTTTGTTGATCTGGCCGGCGAA
>probe:Drosophila_2:1639198_at:114:577; Interrogation_Position=1437; Antisense; GGCCGGCGAACTGGATGACCTAGAT
>probe:Drosophila_2:1639198_at:105:75; Interrogation_Position=1472; Antisense; AGGACGATGACTAGTCCTCCGCGTA
>probe:Drosophila_2:1639198_at:42:505; Interrogation_Position=1485; Antisense; GTCCTCCGCGTAGTTTGTTTGAAAT
>probe:Drosophila_2:1639198_at:143:395; Interrogation_Position=1516; Antisense; GAAATTGATTTCTGCCTTTTAGCTA
>probe:Drosophila_2:1639198_at:496:313; Interrogation_Position=1529; Antisense; GCCTTTTAGCTACCCTTCAATCAAT
>probe:Drosophila_2:1639198_at:379:215; Interrogation_Position=1555; Antisense; AAGTTGTGGCTCTTAATTGTTGCAT

Paste this into a BLAST search page for me
AAGAGTGACTTCAGCAAGGGCAAACAAACAGTTCGGCATCTCTGGTCGCGGGTCGCGAAATGTTCAGCTTCAATCGCTTCAATCCGGATCTGGTCGACGATGCTTTCGACGTCTACAACAGGGAGGATAATGCCGTCGAGTTCAAGGAACTACTGGACCAGGCAACCGAAGCAGCTCTCTTTGTTGATCTGGCCGGCGAAGGCCGGCGAACTGGATGACCTAGATAGGACGATGACTAGTCCTCCGCGTAGTCCTCCGCGTAGTTTGTTTGAAATGAAATTGATTTCTGCCTTTTAGCTAGCCTTTTAGCTACCCTTCAATCAATAAGTTGTGGCTCTTAATTGTTGCAT

Full Affymetrix probeset data:

Annotations for 1639198_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720