Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639204_at:

>probe:Drosophila_2:1639204_at:331:207; Interrogation_Position=1016; Antisense; AAGCGGAGTGCCAGCAGCGGTATCT
>probe:Drosophila_2:1639204_at:704:121; Interrogation_Position=1031; Antisense; AGCGGTATCTGTTGCGCTACTGCAA
>probe:Drosophila_2:1639204_at:313:243; Interrogation_Position=1087; Antisense; AATTATCCCGCCTGTCGGCTAAAGG
>probe:Drosophila_2:1639204_at:488:331; Interrogation_Position=1126; Antisense; GCGGCACACAACCATTTGCTGCAAA
>probe:Drosophila_2:1639204_at:494:659; Interrogation_Position=1235; Antisense; TAACCCTGCTGACCGATATGCGAAA
>probe:Drosophila_2:1639204_at:534:393; Interrogation_Position=1256; Antisense; GAAAGAGTGTCCAGCAACCCTGGCT
>probe:Drosophila_2:1639204_at:319:247; Interrogation_Position=1288; Antisense; AATTCCAGCGCCATCGAGAGCATGT
>probe:Drosophila_2:1639204_at:101:349; Interrogation_Position=1307; Antisense; GCATGTGGCTCAACGTTTACTTCAA
>probe:Drosophila_2:1639204_at:655:413; Interrogation_Position=1356; Antisense; GACCAACCTGATTTACACCTGGGTG
>probe:Drosophila_2:1639204_at:220:365; Interrogation_Position=814; Antisense; GAATCTTCAGTGTGGTTCGGTTTCC
>probe:Drosophila_2:1639204_at:40:229; Interrogation_Position=868; Antisense; AATGTGGCCGTTACAGCGGTGTACC
>probe:Drosophila_2:1639204_at:365:515; Interrogation_Position=886; Antisense; GTGTACCACTACTTCGACGAGAGCA
>probe:Drosophila_2:1639204_at:699:573; Interrogation_Position=932; Antisense; GGCGGCACTGCGTCATGGACTACGA
>probe:Drosophila_2:1639204_at:234:111; Interrogation_Position=968; Antisense; AGCACTTTCGTACGCTGGAGGGCCA

Paste this into a BLAST search page for me
AAGCGGAGTGCCAGCAGCGGTATCTAGCGGTATCTGTTGCGCTACTGCAAAATTATCCCGCCTGTCGGCTAAAGGGCGGCACACAACCATTTGCTGCAAATAACCCTGCTGACCGATATGCGAAAGAAAGAGTGTCCAGCAACCCTGGCTAATTCCAGCGCCATCGAGAGCATGTGCATGTGGCTCAACGTTTACTTCAAGACCAACCTGATTTACACCTGGGTGGAATCTTCAGTGTGGTTCGGTTTCCAATGTGGCCGTTACAGCGGTGTACCGTGTACCACTACTTCGACGAGAGCAGGCGGCACTGCGTCATGGACTACGAAGCACTTTCGTACGCTGGAGGGCCA

Full Affymetrix probeset data:

Annotations for 1639204_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime