FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639206_at:

>probe:Drosophila_2:1639206_at:161:367; Interrogation_Position=1013; Antisense; GAATGCCGAGGGTCTTTCGCAAGCA
>probe:Drosophila_2:1639206_at:314:359; Interrogation_Position=1031; Antisense; GCAAGCAGCGCGATCAATTCTTTGA
>probe:Drosophila_2:1639206_at:64:87; Interrogation_Position=602; Antisense; AGTGCATCCATCTTATTTGGCCACA
>probe:Drosophila_2:1639206_at:684:687; Interrogation_Position=615; Antisense; TATTTGGCCACATCGCTGGGAGCAC
>probe:Drosophila_2:1639206_at:73:193; Interrogation_Position=653; Antisense; AACTACTGGTGGATACGCTCTGTCA
>probe:Drosophila_2:1639206_at:623:337; Interrogation_Position=669; Antisense; GCTCTGTCAGCTCCATGAGCGACAA
>probe:Drosophila_2:1639206_at:263:361; Interrogation_Position=776; Antisense; GCAAGCTGGTGAACTTTGGCCATCT
>probe:Drosophila_2:1639206_at:110:581; Interrogation_Position=792; Antisense; TGGCCATCTGGAGCGTGAAGAGTAC
>probe:Drosophila_2:1639206_at:329:99; Interrogation_Position=810; Antisense; AGAGTACTTGAAGACCCTGCTGACT
>probe:Drosophila_2:1639206_at:692:401; Interrogation_Position=838; Antisense; GACATTGTGATATCAACTGCCGACC
>probe:Drosophila_2:1639206_at:41:195; Interrogation_Position=852; Antisense; AACTGCCGACCATGAGTTTTTTGGA
>probe:Drosophila_2:1639206_at:36:431; Interrogation_Position=875; Antisense; GAGTAGCAATGCTGGAGGCCGCTTT
>probe:Drosophila_2:1639206_at:438:697; Interrogation_Position=897; Antisense; TTTCTGCGGCTGTTATCCCATTGCG
>probe:Drosophila_2:1639206_at:676:185; Interrogation_Position=970; Antisense; AACACCTCCAATGCGCTGACGAAGA

Paste this into a BLAST search page for me
GAATGCCGAGGGTCTTTCGCAAGCAGCAAGCAGCGCGATCAATTCTTTGAAGTGCATCCATCTTATTTGGCCACATATTTGGCCACATCGCTGGGAGCACAACTACTGGTGGATACGCTCTGTCAGCTCTGTCAGCTCCATGAGCGACAAGCAAGCTGGTGAACTTTGGCCATCTTGGCCATCTGGAGCGTGAAGAGTACAGAGTACTTGAAGACCCTGCTGACTGACATTGTGATATCAACTGCCGACCAACTGCCGACCATGAGTTTTTTGGAGAGTAGCAATGCTGGAGGCCGCTTTTTTCTGCGGCTGTTATCCCATTGCGAACACCTCCAATGCGCTGACGAAGA

Full Affymetrix probeset data:

Annotations for 1639206_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720