Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639207_at:

>probe:Drosophila_2:1639207_at:141:727; Interrogation_Position=1678; Antisense; TTGGAAAGCCCTTATCACGGCTCCT
>probe:Drosophila_2:1639207_at:58:175; Interrogation_Position=1682; Antisense; AAAGCCCTTATCACGGCTCCTGGAA
>probe:Drosophila_2:1639207_at:596:679; Interrogation_Position=1689; Antisense; TTATCACGGCTCCTGGAAACTGAAA
>probe:Drosophila_2:1639207_at:608:571; Interrogation_Position=1696; Antisense; GGCTCCTGGAAACTGAAAAAGCTGG
>probe:Drosophila_2:1639207_at:184:229; Interrogation_Position=1770; Antisense; AATAAAAGCCATATCCAAGTGTGGG
>probe:Drosophila_2:1639207_at:328:687; Interrogation_Position=1803; Antisense; TATTAGAGTAAGACAATCGGGAGCG
>probe:Drosophila_2:1639207_at:356:53; Interrogation_Position=1835; Antisense; ATGCATCTGGGCTACATGTGGTATG
>probe:Drosophila_2:1639207_at:508:571; Interrogation_Position=1844; Antisense; GGCTACATGTGGTATGTGAGCAATA
>probe:Drosophila_2:1639207_at:478:691; Interrogation_Position=1947; Antisense; TTAGCGCCCACTTAAACACGTTAGC
>probe:Drosophila_2:1639207_at:178:317; Interrogation_Position=1952; Antisense; GCCCACTTAAACACGTTAGCGAATG
>probe:Drosophila_2:1639207_at:453:143; Interrogation_Position=1956; Antisense; ACTTAAACACGTTAGCGAATGATCT
>probe:Drosophila_2:1639207_at:729:493; Interrogation_Position=2040; Antisense; GTAATATAGCATAATCTCTCCTCGG
>probe:Drosophila_2:1639207_at:119:685; Interrogation_Position=2044; Antisense; TATAGCATAATCTCTCCTCGGTACA
>probe:Drosophila_2:1639207_at:705:147; Interrogation_Position=2131; Antisense; ACTTCAGAAGGAACTGATCGATTCC

Paste this into a BLAST search page for me
TTGGAAAGCCCTTATCACGGCTCCTAAAGCCCTTATCACGGCTCCTGGAATTATCACGGCTCCTGGAAACTGAAAGGCTCCTGGAAACTGAAAAAGCTGGAATAAAAGCCATATCCAAGTGTGGGTATTAGAGTAAGACAATCGGGAGCGATGCATCTGGGCTACATGTGGTATGGGCTACATGTGGTATGTGAGCAATATTAGCGCCCACTTAAACACGTTAGCGCCCACTTAAACACGTTAGCGAATGACTTAAACACGTTAGCGAATGATCTGTAATATAGCATAATCTCTCCTCGGTATAGCATAATCTCTCCTCGGTACAACTTCAGAAGGAACTGATCGATTCC

Full Affymetrix probeset data:

Annotations for 1639207_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime