Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639208_at:

>probe:Drosophila_2:1639208_at:167:407; Interrogation_Position=6858; Antisense; GACGGCGTCTCCTCCGAGGGTGAAA
>probe:Drosophila_2:1639208_at:581:545; Interrogation_Position=6920; Antisense; GGAGGCCACTTCACCGTCGGAGAAC
>probe:Drosophila_2:1639208_at:475:551; Interrogation_Position=6938; Antisense; GGAGAACACGCGATTTCGCACGCTG
>probe:Drosophila_2:1639208_at:451:503; Interrogation_Position=7030; Antisense; GTCCGCAGCGGATTGTCTGGCAACG
>probe:Drosophila_2:1639208_at:235:135; Interrogation_Position=7059; Antisense; ACGTCGCCGGGAAACATTCAGCAAA
>probe:Drosophila_2:1639208_at:541:633; Interrogation_Position=7076; Antisense; TCAGCAAAACCAGATGTCAGCCAAT
>probe:Drosophila_2:1639208_at:507:661; Interrogation_Position=7100; Antisense; TAACAATCGCTTTGCGCAACGGACC
>probe:Drosophila_2:1639208_at:325:407; Interrogation_Position=7177; Antisense; GACGATTCCCCTAGGGCGAGGAGTT
>probe:Drosophila_2:1639208_at:485:393; Interrogation_Position=7218; Antisense; GAAAGTCCGCTGTAGGCTGACTATA
>probe:Drosophila_2:1639208_at:414:165; Interrogation_Position=7243; Antisense; AAATCATTGCGTTTACTGGGCTAGA
>probe:Drosophila_2:1639208_at:310:525; Interrogation_Position=7260; Antisense; GGGCTAGAAATAAGTCTCCTCGCAT
>probe:Drosophila_2:1639208_at:664:21; Interrogation_Position=7320; Antisense; ATATTACTCTACATTCTCCAGCTTG
>probe:Drosophila_2:1639208_at:318:721; Interrogation_Position=7342; Antisense; TTGCGAGTCCTGAGTTTCTGCAGTT
>probe:Drosophila_2:1639208_at:139:85; Interrogation_Position=7379; Antisense; AGAGCTTTGGTTCTTGTACATTAAC

Paste this into a BLAST search page for me
GACGGCGTCTCCTCCGAGGGTGAAAGGAGGCCACTTCACCGTCGGAGAACGGAGAACACGCGATTTCGCACGCTGGTCCGCAGCGGATTGTCTGGCAACGACGTCGCCGGGAAACATTCAGCAAATCAGCAAAACCAGATGTCAGCCAATTAACAATCGCTTTGCGCAACGGACCGACGATTCCCCTAGGGCGAGGAGTTGAAAGTCCGCTGTAGGCTGACTATAAAATCATTGCGTTTACTGGGCTAGAGGGCTAGAAATAAGTCTCCTCGCATATATTACTCTACATTCTCCAGCTTGTTGCGAGTCCTGAGTTTCTGCAGTTAGAGCTTTGGTTCTTGTACATTAAC

Full Affymetrix probeset data:

Annotations for 1639208_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime