FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639210_at:

>probe:Drosophila_2:1639210_at:170:391; Interrogation_Position=262; Antisense; GAAACGACCGTTGGCGAGGCACCCA
>probe:Drosophila_2:1639210_at:262:133; Interrogation_Position=282; Antisense; ACCCATCATCGGATCGTCGGAAGGA
>probe:Drosophila_2:1639210_at:416:609; Interrogation_Position=347; Antisense; TGAGCACAAACCCATCGAGCAGCAG
>probe:Drosophila_2:1639210_at:680:351; Interrogation_Position=365; Antisense; GCAGCAGCAGTCTGGTTAGCACCAT
>probe:Drosophila_2:1639210_at:209:79; Interrogation_Position=422; Antisense; AGGATAATCAGCCAGTGCCGTGCAC
>probe:Drosophila_2:1639210_at:552:173; Interrogation_Position=492; Antisense; AAAGCCACTTATCCACCAGGAATTG
>probe:Drosophila_2:1639210_at:271:545; Interrogation_Position=516; Antisense; GGATCATATGTTTCCCTGCAATGCC
>probe:Drosophila_2:1639210_at:207:315; Interrogation_Position=538; Antisense; GCCATCGGTCGCAAGCAGTGTCAAA
>probe:Drosophila_2:1639210_at:368:409; Interrogation_Position=576; Antisense; GACGATCGTACAACATCTGCCGAAT
>probe:Drosophila_2:1639210_at:438:243; Interrogation_Position=607; Antisense; AATATAGTATGCTCCGCACTGGGTC
>probe:Drosophila_2:1639210_at:490:297; Interrogation_Position=621; Antisense; CGCACTGGGTCACGATTGTCACAAG
>probe:Drosophila_2:1639210_at:656:73; Interrogation_Position=644; Antisense; AGGAACGGGCCTATTTGTTCATCAA
>probe:Drosophila_2:1639210_at:67:473; Interrogation_Position=688; Antisense; GTTAATACCAATCTGCAGGCGGGCA
>probe:Drosophila_2:1639210_at:624:267; Interrogation_Position=711; Antisense; CAGGGAGTACTGTTGTCGCTCTGGC

Paste this into a BLAST search page for me
GAAACGACCGTTGGCGAGGCACCCAACCCATCATCGGATCGTCGGAAGGATGAGCACAAACCCATCGAGCAGCAGGCAGCAGCAGTCTGGTTAGCACCATAGGATAATCAGCCAGTGCCGTGCACAAAGCCACTTATCCACCAGGAATTGGGATCATATGTTTCCCTGCAATGCCGCCATCGGTCGCAAGCAGTGTCAAAGACGATCGTACAACATCTGCCGAATAATATAGTATGCTCCGCACTGGGTCCGCACTGGGTCACGATTGTCACAAGAGGAACGGGCCTATTTGTTCATCAAGTTAATACCAATCTGCAGGCGGGCACAGGGAGTACTGTTGTCGCTCTGGC

Full Affymetrix probeset data:

Annotations for 1639210_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720