FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639211_at:

>probe:Drosophila_2:1639211_at:16:461; Interrogation_Position=395; Antisense; GATTAGCTTAATCCTCTGTGGGTCC
>probe:Drosophila_2:1639211_at:59:461; Interrogation_Position=439; Antisense; GATTTCTCACTGCTAACTGCAGAAG
>probe:Drosophila_2:1639211_at:160:533; Interrogation_Position=463; Antisense; GGTGGACTAAATGCGATGACCTGAA
>probe:Drosophila_2:1639211_at:482:413; Interrogation_Position=480; Antisense; GACCTGAAGTCACAGGCGCAGCCTC
>probe:Drosophila_2:1639211_at:25:299; Interrogation_Position=496; Antisense; CGCAGCCTCGATGCGGCGTATAAAT
>probe:Drosophila_2:1639211_at:202:461; Interrogation_Position=529; Antisense; GATTAGTCCAATATGCTACAGGCGA
>probe:Drosophila_2:1639211_at:466:275; Interrogation_Position=619; Antisense; CTTGTCTTGGCCTGAACTGCTTGGT
>probe:Drosophila_2:1639211_at:403:613; Interrogation_Position=631; Antisense; TGAACTGCTTGGTGCGCCTTGGCCT
>probe:Drosophila_2:1639211_at:568:313; Interrogation_Position=646; Antisense; GCCTTGGCCTACATTGCTAACGTGG
>probe:Drosophila_2:1639211_at:638:629; Interrogation_Position=681; Antisense; TCCTCTGGTCTGACTGTCGTAGTAG
>probe:Drosophila_2:1639211_at:381:143; Interrogation_Position=693; Antisense; ACTGTCGTAGTAGCTGGTCTCTCTC
>probe:Drosophila_2:1639211_at:252:91; Interrogation_Position=701; Antisense; AGTAGCTGGTCTCTCTCCAGTTGTG
>probe:Drosophila_2:1639211_at:347:337; Interrogation_Position=729; Antisense; GCTGCCAGTTGTCAGGTTAATGAAT
>probe:Drosophila_2:1639211_at:245:615; Interrogation_Position=749; Antisense; TGAATGAAATCGCTCTTGCTCCTGT

Paste this into a BLAST search page for me
GATTAGCTTAATCCTCTGTGGGTCCGATTTCTCACTGCTAACTGCAGAAGGGTGGACTAAATGCGATGACCTGAAGACCTGAAGTCACAGGCGCAGCCTCCGCAGCCTCGATGCGGCGTATAAATGATTAGTCCAATATGCTACAGGCGACTTGTCTTGGCCTGAACTGCTTGGTTGAACTGCTTGGTGCGCCTTGGCCTGCCTTGGCCTACATTGCTAACGTGGTCCTCTGGTCTGACTGTCGTAGTAGACTGTCGTAGTAGCTGGTCTCTCTCAGTAGCTGGTCTCTCTCCAGTTGTGGCTGCCAGTTGTCAGGTTAATGAATTGAATGAAATCGCTCTTGCTCCTGT

Full Affymetrix probeset data:

Annotations for 1639211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720