Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639215_at:

>probe:Drosophila_2:1639215_at:697:499; Interrogation_Position=1487; Antisense; GTCTGGACAATTCGTAGCACTTTCT
>probe:Drosophila_2:1639215_at:366:487; Interrogation_Position=1500; Antisense; GTAGCACTTTCTGTTGAGACGATAA
>probe:Drosophila_2:1639215_at:641:263; Interrogation_Position=1626; Antisense; CAGCTTGAATGCACGTTTTATTGAT
>probe:Drosophila_2:1639215_at:569:245; Interrogation_Position=1657; Antisense; AATTGTTACTTTGCGAATGCTGAGG
>probe:Drosophila_2:1639215_at:514:481; Interrogation_Position=1692; Antisense; GTATTTACTGGACAACACCACACAT
>probe:Drosophila_2:1639215_at:454:25; Interrogation_Position=1715; Antisense; ATACCGTGCCTATCCTTTTGTAAAT
>probe:Drosophila_2:1639215_at:670:723; Interrogation_Position=1732; Antisense; TTGTAAATATCCACTTGCACTCAAG
>probe:Drosophila_2:1639215_at:688:251; Interrogation_Position=1790; Antisense; CAAGTTACACTTGATGTTCGGCCAA
>probe:Drosophila_2:1639215_at:193:59; Interrogation_Position=1803; Antisense; ATGTTCGGCCAATTCACAGCCACAA
>probe:Drosophila_2:1639215_at:709:155; Interrogation_Position=1818; Antisense; ACAGCCACAACTACTTTTGTTCGAA
>probe:Drosophila_2:1639215_at:500:509; Interrogation_Position=1889; Antisense; GTGCATTATTTATTCATTGCCAATT
>probe:Drosophila_2:1639215_at:405:395; Interrogation_Position=1927; Antisense; GAAATCCTAGGTTGAGCCAGCCCAG
>probe:Drosophila_2:1639215_at:583:415; Interrogation_Position=1940; Antisense; GAGCCAGCCCAGACTTATATATTTG
>probe:Drosophila_2:1639215_at:65:219; Interrogation_Position=1976; Antisense; AAGTCGCATTACTCGCACAGTGTTT

Paste this into a BLAST search page for me
GTCTGGACAATTCGTAGCACTTTCTGTAGCACTTTCTGTTGAGACGATAACAGCTTGAATGCACGTTTTATTGATAATTGTTACTTTGCGAATGCTGAGGGTATTTACTGGACAACACCACACATATACCGTGCCTATCCTTTTGTAAATTTGTAAATATCCACTTGCACTCAAGCAAGTTACACTTGATGTTCGGCCAAATGTTCGGCCAATTCACAGCCACAAACAGCCACAACTACTTTTGTTCGAAGTGCATTATTTATTCATTGCCAATTGAAATCCTAGGTTGAGCCAGCCCAGGAGCCAGCCCAGACTTATATATTTGAAGTCGCATTACTCGCACAGTGTTT

Full Affymetrix probeset data:

Annotations for 1639215_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime