FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639219_at:

>probe:Drosophila_2:1639219_at:576:343; Interrogation_Position=1022; Antisense; GCATTTTATTTCCATAGCAACGTTG
>probe:Drosophila_2:1639219_at:273:219; Interrogation_Position=536; Antisense; AAGTGCGCCATTTTCTGCGTACGAA
>probe:Drosophila_2:1639219_at:254:283; Interrogation_Position=550; Antisense; CTGCGTACGAAATGTGCTGCTGGAA
>probe:Drosophila_2:1639219_at:557:331; Interrogation_Position=568; Antisense; GCTGGAAAGCAGCTACCGCGGACTT
>probe:Drosophila_2:1639219_at:428:131; Interrogation_Position=582; Antisense; ACCGCGGACTTCTGCGCAAGGAGGA
>probe:Drosophila_2:1639219_at:124:43; Interrogation_Position=627; Antisense; ATCGCGTCGATATCTACAAGTCCTT
>probe:Drosophila_2:1639219_at:229:327; Interrogation_Position=660; Antisense; GCGATGTCATCCTGGCGAGGGTCAT
>probe:Drosophila_2:1639219_at:514:531; Interrogation_Position=678; Antisense; GGGTCATTAACCAACTGGAGCAGTC
>probe:Drosophila_2:1639219_at:18:295; Interrogation_Position=721; Antisense; CGAAAATGAACTCGGCGTGGTCATC
>probe:Drosophila_2:1639219_at:315:45; Interrogation_Position=743; Antisense; ATCGCCTATGCCAGTGATTACCGGA
>probe:Drosophila_2:1639219_at:24:125; Interrogation_Position=821; Antisense; ACCACGATCAAGGAGCCACGGAAAG
>probe:Drosophila_2:1639219_at:559:279; Interrogation_Position=849; Antisense; CTAAAGTTCTGCCTGAGAGTTCAAT
>probe:Drosophila_2:1639219_at:561:655; Interrogation_Position=887; Antisense; TAAGGTCAATCGCATGTTAATCAGA
>probe:Drosophila_2:1639219_at:404:681; Interrogation_Position=973; Antisense; TATGTCTTGGCAACCAGAGGACGCT

Paste this into a BLAST search page for me
GCATTTTATTTCCATAGCAACGTTGAAGTGCGCCATTTTCTGCGTACGAACTGCGTACGAAATGTGCTGCTGGAAGCTGGAAAGCAGCTACCGCGGACTTACCGCGGACTTCTGCGCAAGGAGGAATCGCGTCGATATCTACAAGTCCTTGCGATGTCATCCTGGCGAGGGTCATGGGTCATTAACCAACTGGAGCAGTCCGAAAATGAACTCGGCGTGGTCATCATCGCCTATGCCAGTGATTACCGGAACCACGATCAAGGAGCCACGGAAAGCTAAAGTTCTGCCTGAGAGTTCAATTAAGGTCAATCGCATGTTAATCAGATATGTCTTGGCAACCAGAGGACGCT

Full Affymetrix probeset data:

Annotations for 1639219_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720