Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639220_at:

>probe:Drosophila_2:1639220_at:474:351; Interrogation_Position=1694; Antisense; GCAGATGTTACAGCGTGTCCTGTTT
>probe:Drosophila_2:1639220_at:575:151; Interrogation_Position=1736; Antisense; ACATCATTTGACAGTCCTTTGGCAA
>probe:Drosophila_2:1639220_at:576:507; Interrogation_Position=1768; Antisense; GTGAGGGTACGGGTCTCCAGCTAAC
>probe:Drosophila_2:1639220_at:370:43; Interrogation_Position=1795; Antisense; ATCGATCTGGAAAACTTCGCCACCG
>probe:Drosophila_2:1639220_at:617:717; Interrogation_Position=1810; Antisense; TTCGCCACCGCATGCTAATGTGTAT
>probe:Drosophila_2:1639220_at:463:439; Interrogation_Position=1879; Antisense; GATGGCAATCTTTGACCTTAACGGT
>probe:Drosophila_2:1639220_at:343:261; Interrogation_Position=1949; Antisense; CACCGTAGAAGAATGCCTGCGTCTG
>probe:Drosophila_2:1639220_at:243:133; Interrogation_Position=1982; Antisense; ACCCACTGCCAACACGTTTGTGAAA
>probe:Drosophila_2:1639220_at:51:395; Interrogation_Position=2003; Antisense; GAAATCTCTATACACACTCGGTCAT
>probe:Drosophila_2:1639220_at:135:145; Interrogation_Position=2018; Antisense; ACTCGGTCATGTGTGTCTCAACTTT
>probe:Drosophila_2:1639220_at:690:727; Interrogation_Position=2042; Antisense; TTGTGACTTTGTGGAATCCTCGATA
>probe:Drosophila_2:1639220_at:195:181; Interrogation_Position=2124; Antisense; AAAAGCTTTTTGACCAGCATTTTGG
>probe:Drosophila_2:1639220_at:651:105; Interrogation_Position=2177; Antisense; AGACATTGCGGAACGGGACTCCTGT
>probe:Drosophila_2:1639220_at:13:529; Interrogation_Position=2191; Antisense; GGGACTCCTGTAAACAATTGCTCAA

Paste this into a BLAST search page for me
GCAGATGTTACAGCGTGTCCTGTTTACATCATTTGACAGTCCTTTGGCAAGTGAGGGTACGGGTCTCCAGCTAACATCGATCTGGAAAACTTCGCCACCGTTCGCCACCGCATGCTAATGTGTATGATGGCAATCTTTGACCTTAACGGTCACCGTAGAAGAATGCCTGCGTCTGACCCACTGCCAACACGTTTGTGAAAGAAATCTCTATACACACTCGGTCATACTCGGTCATGTGTGTCTCAACTTTTTGTGACTTTGTGGAATCCTCGATAAAAAGCTTTTTGACCAGCATTTTGGAGACATTGCGGAACGGGACTCCTGTGGGACTCCTGTAAACAATTGCTCAA

Full Affymetrix probeset data:

Annotations for 1639220_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime