FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639221_at:

>probe:Drosophila_2:1639221_at:716:137; Interrogation_Position=2758; Antisense; ACGATGACCCCGACGACTGCCAGAT
>probe:Drosophila_2:1639221_at:648:95; Interrogation_Position=2779; Antisense; AGATCACGGGCGAGTACCAGCAGTA
>probe:Drosophila_2:1639221_at:216:91; Interrogation_Position=2800; Antisense; AGTACGACGAACTGAGCTCCAGCAG
>probe:Drosophila_2:1639221_at:718:335; Interrogation_Position=2815; Antisense; GCTCCAGCAGTTAGACCACATGGTT
>probe:Drosophila_2:1639221_at:135:259; Interrogation_Position=2831; Antisense; CACATGGTTCCACGCATCCGGAGGA
>probe:Drosophila_2:1639221_at:386:405; Interrogation_Position=2854; Antisense; GACTCCACTGAATTTATCTCCTAGC
>probe:Drosophila_2:1639221_at:339:39; Interrogation_Position=2869; Antisense; ATCTCCTAGCTGTGAAACCTATCGA
>probe:Drosophila_2:1639221_at:658:201; Interrogation_Position=2884; Antisense; AACCTATCGAGCATACTTTCAGTAT
>probe:Drosophila_2:1639221_at:368:11; Interrogation_Position=2915; Antisense; ATTCAATTCGAATCCACTCCATTGC
>probe:Drosophila_2:1639221_at:256:369; Interrogation_Position=2924; Antisense; GAATCCACTCCATTGCATTGCATTG
>probe:Drosophila_2:1639221_at:127:391; Interrogation_Position=3038; Antisense; GACAACCGACTCTGTTTTGTTAGTT
>probe:Drosophila_2:1639221_at:412:477; Interrogation_Position=3064; Antisense; GTTTTTTCACCCAATGATGCATTCT
>probe:Drosophila_2:1639221_at:546:145; Interrogation_Position=3134; Antisense; TACTTTTCGAACTGCAAGGTGTGTT
>probe:Drosophila_2:1639221_at:212:593; Interrogation_Position=3153; Antisense; TGTGTTGGCGCGAATGGCATGCATT

Paste this into a BLAST search page for me
ACGATGACCCCGACGACTGCCAGATAGATCACGGGCGAGTACCAGCAGTAAGTACGACGAACTGAGCTCCAGCAGGCTCCAGCAGTTAGACCACATGGTTCACATGGTTCCACGCATCCGGAGGAGACTCCACTGAATTTATCTCCTAGCATCTCCTAGCTGTGAAACCTATCGAAACCTATCGAGCATACTTTCAGTATATTCAATTCGAATCCACTCCATTGCGAATCCACTCCATTGCATTGCATTGGACAACCGACTCTGTTTTGTTAGTTGTTTTTTCACCCAATGATGCATTCTTACTTTTCGAACTGCAAGGTGTGTTTGTGTTGGCGCGAATGGCATGCATT

Full Affymetrix probeset data:

Annotations for 1639221_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720