Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639222_at:

>probe:Drosophila_2:1639222_at:427:197; Interrogation_Position=1546; Antisense; AATCTGGTTTACTCCGAGAGGCACT
>probe:Drosophila_2:1639222_at:711:425; Interrogation_Position=1561; Antisense; GAGAGGCACTCCGACGTTTTGACCG
>probe:Drosophila_2:1639222_at:14:301; Interrogation_Position=1584; Antisense; CGCCCTGCGAAGACGTGTTCAAGAA
>probe:Drosophila_2:1639222_at:100:103; Interrogation_Position=1612; Antisense; AGAGCAAGTGCATCACGCCCGGGCA
>probe:Drosophila_2:1639222_at:546:361; Interrogation_Position=1634; Antisense; GCAATCGTGCCAGCATGCCGGAGGC
>probe:Drosophila_2:1639222_at:257:625; Interrogation_Position=1649; Antisense; TGCCGGAGGCAGATCCCACATTGCA
>probe:Drosophila_2:1639222_at:378:151; Interrogation_Position=1666; Antisense; ACATTGCACACCTGCGCCTGGGAGT
>probe:Drosophila_2:1639222_at:585:317; Interrogation_Position=1681; Antisense; GCCTGGGAGTCCTTTGAAGTGCTGA
>probe:Drosophila_2:1639222_at:147:471; Interrogation_Position=1779; Antisense; GTTCCCTTGGAATGCGACTACGTAG
>probe:Drosophila_2:1639222_at:317:403; Interrogation_Position=1794; Antisense; GACTACGTAGGCGTACCTTGTTAAT
>probe:Drosophila_2:1639222_at:329:27; Interrogation_Position=1844; Antisense; ATACGATGCAGACTATTGGATTACA
>probe:Drosophila_2:1639222_at:188:199; Interrogation_Position=1957; Antisense; AACGATTATGCTTTTGCTCTGTAAC
>probe:Drosophila_2:1639222_at:560:655; Interrogation_Position=1991; Antisense; TAAGCCTAACAGTTCCATAACGACT
>probe:Drosophila_2:1639222_at:341:347; Interrogation_Position=2029; Antisense; GCATCTGGCAGCTCTGTATTTTGAA

Paste this into a BLAST search page for me
AATCTGGTTTACTCCGAGAGGCACTGAGAGGCACTCCGACGTTTTGACCGCGCCCTGCGAAGACGTGTTCAAGAAAGAGCAAGTGCATCACGCCCGGGCAGCAATCGTGCCAGCATGCCGGAGGCTGCCGGAGGCAGATCCCACATTGCAACATTGCACACCTGCGCCTGGGAGTGCCTGGGAGTCCTTTGAAGTGCTGAGTTCCCTTGGAATGCGACTACGTAGGACTACGTAGGCGTACCTTGTTAATATACGATGCAGACTATTGGATTACAAACGATTATGCTTTTGCTCTGTAACTAAGCCTAACAGTTCCATAACGACTGCATCTGGCAGCTCTGTATTTTGAA

Full Affymetrix probeset data:

Annotations for 1639222_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime