FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639225_at:

>probe:Drosophila_2:1639225_at:591:351; Interrogation_Position=102; Antisense; GCAGCAGCCAAAAGGGACGCCCAAT
>probe:Drosophila_2:1639225_at:557:529; Interrogation_Position=129; Antisense; GGGATATCACCTGTATCTGTACCGC
>probe:Drosophila_2:1639225_at:96:627; Interrogation_Position=14; Antisense; TGCCGCGCTACCAGAAACTCATCAA
>probe:Drosophila_2:1639225_at:467:673; Interrogation_Position=148; Antisense; TACCGCCAGCAACTTTCTCAGAAGA
>probe:Drosophila_2:1639225_at:506:487; Interrogation_Position=180; Antisense; GTACATGAGGTTGTCCAAGGCCAAG
>probe:Drosophila_2:1639225_at:563:69; Interrogation_Position=197; Antisense; AGGCCAAGTACTTTATCACCGACAC
>probe:Drosophila_2:1639225_at:384:157; Interrogation_Position=220; Antisense; ACACTGCTGGCCAAAACGGTTCGGA
>probe:Drosophila_2:1639225_at:404:19; Interrogation_Position=245; Antisense; ATTTGAAAGGATACAGCGCCGACGA
>probe:Drosophila_2:1639225_at:651:123; Interrogation_Position=259; Antisense; AGCGCCGACGAGTTGAAGACTGTTA
>probe:Drosophila_2:1639225_at:581:707; Interrogation_Position=281; Antisense; TTAACCATCAGATCGTCTTTCGGCA
>probe:Drosophila_2:1639225_at:4:19; Interrogation_Position=292; Antisense; ATCGTCTTTCGGCATAAACTTCGTC
>probe:Drosophila_2:1639225_at:201:179; Interrogation_Position=307; Antisense; AAACTTCGTCGCCAGATTCAGCGGC
>probe:Drosophila_2:1639225_at:57:463; Interrogation_Position=321; Antisense; GATTCAGCGGCTTCGCAAGTTAAGA
>probe:Drosophila_2:1639225_at:277:369; Interrogation_Position=40; Antisense; GAATGCGACAGCAAGCCTGCGAAAA

Paste this into a BLAST search page for me
GCAGCAGCCAAAAGGGACGCCCAATGGGATATCACCTGTATCTGTACCGCTGCCGCGCTACCAGAAACTCATCAATACCGCCAGCAACTTTCTCAGAAGAGTACATGAGGTTGTCCAAGGCCAAGAGGCCAAGTACTTTATCACCGACACACACTGCTGGCCAAAACGGTTCGGAATTTGAAAGGATACAGCGCCGACGAAGCGCCGACGAGTTGAAGACTGTTATTAACCATCAGATCGTCTTTCGGCAATCGTCTTTCGGCATAAACTTCGTCAAACTTCGTCGCCAGATTCAGCGGCGATTCAGCGGCTTCGCAAGTTAAGAGAATGCGACAGCAAGCCTGCGAAAA

Full Affymetrix probeset data:

Annotations for 1639225_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720