FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639228_at:

>probe:Drosophila_2:1639228_at:281:255; Interrogation_Position=1015; Antisense; CAACATCCTTATTGTGGGCGGCAGT
>probe:Drosophila_2:1639228_at:692:81; Interrogation_Position=1037; Antisense; AGTGCCCAGTTTCCGGGATTTCTGC
>probe:Drosophila_2:1639228_at:210:663; Interrogation_Position=1068; Antisense; TAAAGCGCGATTTACGTGCCCTGGT
>probe:Drosophila_2:1639228_at:292:535; Interrogation_Position=1090; Antisense; GGTGCCCGACGATCTTGAAGTGTCA
>probe:Drosophila_2:1639228_at:209:221; Interrogation_Position=1107; Antisense; AAGTGTCACTCATCTGTCCCGAGGA
>probe:Drosophila_2:1639228_at:624:413; Interrogation_Position=1171; Antisense; GACCAGCCCCAACTTTGAAGAGTTT
>probe:Drosophila_2:1639228_at:446:429; Interrogation_Position=1220; Antisense; GAGTACGGTTTCCAGGGTATCAATC
>probe:Drosophila_2:1639228_at:241:35; Interrogation_Position=1242; Antisense; ATCAGCGGTAACATGCACGTAGTCG
>probe:Drosophila_2:1639228_at:293:149; Interrogation_Position=1287; Antisense; ACTTGATTTGCACATGGGTTTTCTA
>probe:Drosophila_2:1639228_at:426:495; Interrogation_Position=773; Antisense; GTCACAGTTGATTATGTCCTTCCAG
>probe:Drosophila_2:1639228_at:499:569; Interrogation_Position=818; Antisense; GGCTATGTTCGTGTTCCCGGAAAGC
>probe:Drosophila_2:1639228_at:724:515; Interrogation_Position=872; Antisense; GTGTCGCTGTGCAATGAACGTTTCA
>probe:Drosophila_2:1639228_at:667:235; Interrogation_Position=917; Antisense; AATCCCTCGGACATTGGTGTGCAAC
>probe:Drosophila_2:1639228_at:441:5; Interrogation_Position=969; Antisense; ATTGTCTGAAGGCTTGCCCCTGGGA

Paste this into a BLAST search page for me
CAACATCCTTATTGTGGGCGGCAGTAGTGCCCAGTTTCCGGGATTTCTGCTAAAGCGCGATTTACGTGCCCTGGTGGTGCCCGACGATCTTGAAGTGTCAAAGTGTCACTCATCTGTCCCGAGGAGACCAGCCCCAACTTTGAAGAGTTTGAGTACGGTTTCCAGGGTATCAATCATCAGCGGTAACATGCACGTAGTCGACTTGATTTGCACATGGGTTTTCTAGTCACAGTTGATTATGTCCTTCCAGGGCTATGTTCGTGTTCCCGGAAAGCGTGTCGCTGTGCAATGAACGTTTCAAATCCCTCGGACATTGGTGTGCAACATTGTCTGAAGGCTTGCCCCTGGGA

Full Affymetrix probeset data:

Annotations for 1639228_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720