FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639229_at:

>probe:Drosophila_2:1639229_at:478:85; Interrogation_Position=5782; Antisense; AGTCCTGGTTCCAATCCCGAATCTA
>probe:Drosophila_2:1639229_at:17:333; Interrogation_Position=5846; Antisense; GCGGCCCATCAAACTATCTGAACGG
>probe:Drosophila_2:1639229_at:329:223; Interrogation_Position=5883; Antisense; AAGGGTTCACCCGAGCAACCTGCAG
>probe:Drosophila_2:1639229_at:103:253; Interrogation_Position=5898; Antisense; CAACCTGCAGGCCTACGATGAGTAT
>probe:Drosophila_2:1639229_at:88:671; Interrogation_Position=5911; Antisense; TACGATGAGTATGCTCGCCATGGTG
>probe:Drosophila_2:1639229_at:315:63; Interrogation_Position=5930; Antisense; ATGGTGGCAATACCCGCCAGTACAA
>probe:Drosophila_2:1639229_at:504:301; Interrogation_Position=5982; Antisense; CCCCTAGATTGCAGTTCGAACTAAG
>probe:Drosophila_2:1639229_at:232:217; Interrogation_Position=6028; Antisense; AAGTAATTTGCTATCCTATCCAGGA
>probe:Drosophila_2:1639229_at:640:425; Interrogation_Position=6056; Antisense; GAGATAACGATCCAAACCCCAACTC
>probe:Drosophila_2:1639229_at:418:385; Interrogation_Position=6111; Antisense; GAACAGTGCCATTTTCCGTGGAGAT
>probe:Drosophila_2:1639229_at:298:423; Interrogation_Position=6226; Antisense; GAGAAGAGTAACCACTGCCTCCACT
>probe:Drosophila_2:1639229_at:514:143; Interrogation_Position=6239; Antisense; ACTGCCTCCACTGCAACGAAAGTAA
>probe:Drosophila_2:1639229_at:166:169; Interrogation_Position=6257; Antisense; AAAGTAAATCTTGTGCCCCTGTTGG
>probe:Drosophila_2:1639229_at:555:319; Interrogation_Position=6271; Antisense; GCCCCTGTTGGGATTATTGTAAACG

Paste this into a BLAST search page for me
AGTCCTGGTTCCAATCCCGAATCTAGCGGCCCATCAAACTATCTGAACGGAAGGGTTCACCCGAGCAACCTGCAGCAACCTGCAGGCCTACGATGAGTATTACGATGAGTATGCTCGCCATGGTGATGGTGGCAATACCCGCCAGTACAACCCCTAGATTGCAGTTCGAACTAAGAAGTAATTTGCTATCCTATCCAGGAGAGATAACGATCCAAACCCCAACTCGAACAGTGCCATTTTCCGTGGAGATGAGAAGAGTAACCACTGCCTCCACTACTGCCTCCACTGCAACGAAAGTAAAAAGTAAATCTTGTGCCCCTGTTGGGCCCCTGTTGGGATTATTGTAAACG

Full Affymetrix probeset data:

Annotations for 1639229_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720