FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639230_at:

>probe:Drosophila_2:1639230_at:569:201; Interrogation_Position=7072; Antisense; AACCGGCAGCAGTCCATGACGTTGG
>probe:Drosophila_2:1639230_at:20:57; Interrogation_Position=7087; Antisense; ATGACGTTGGCCTACTTTGGAGCTC
>probe:Drosophila_2:1639230_at:722:641; Interrogation_Position=7110; Antisense; TCTGCTCGCCGACGTGGATTACAAC
>probe:Drosophila_2:1639230_at:511:147; Interrogation_Position=7188; Antisense; ACTAGCAGACACTCTGGCTGGTTAC
>probe:Drosophila_2:1639230_at:393:69; Interrogation_Position=7241; Antisense; AGGCCGCCTGCATGTTCAAACAGAA
>probe:Drosophila_2:1639230_at:7:379; Interrogation_Position=7263; Antisense; GAAGCTGCTACTTTCTGAGAGCTAC
>probe:Drosophila_2:1639230_at:168:257; Interrogation_Position=7306; Antisense; CACAGCGATGTGGTCTTGATCAAGT
>probe:Drosophila_2:1639230_at:89:653; Interrogation_Position=7325; Antisense; TCAAGTCGGCCGAGCACAATGCGAT
>probe:Drosophila_2:1639230_at:449:357; Interrogation_Position=7338; Antisense; GCACAATGCGATTATGGCCCAGGAC
>probe:Drosophila_2:1639230_at:583:321; Interrogation_Position=7354; Antisense; GCCCAGGACTATGGCCTCAAGGAGA
>probe:Drosophila_2:1639230_at:656:427; Interrogation_Position=7375; Antisense; GAGATTTGCAGTGCCCAGATCGACA
>probe:Drosophila_2:1639230_at:327:585; Interrogation_Position=7409; Antisense; TGGAGGGTACACACAGGACCTTCCT
>probe:Drosophila_2:1639230_at:263:631; Interrogation_Position=7469; Antisense; TCCTGCGGAAGCGTCCCTAGTGGAA
>probe:Drosophila_2:1639230_at:425:651; Interrogation_Position=7564; Antisense; TCAATACACGTAGCAATCGCGCATT

Paste this into a BLAST search page for me
AACCGGCAGCAGTCCATGACGTTGGATGACGTTGGCCTACTTTGGAGCTCTCTGCTCGCCGACGTGGATTACAACACTAGCAGACACTCTGGCTGGTTACAGGCCGCCTGCATGTTCAAACAGAAGAAGCTGCTACTTTCTGAGAGCTACCACAGCGATGTGGTCTTGATCAAGTTCAAGTCGGCCGAGCACAATGCGATGCACAATGCGATTATGGCCCAGGACGCCCAGGACTATGGCCTCAAGGAGAGAGATTTGCAGTGCCCAGATCGACATGGAGGGTACACACAGGACCTTCCTTCCTGCGGAAGCGTCCCTAGTGGAATCAATACACGTAGCAATCGCGCATT

Full Affymetrix probeset data:

Annotations for 1639230_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720