Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639233_at:

>probe:Drosophila_2:1639233_at:210:571; Interrogation_Position=3599; Antisense; GGCTTAAGCTGGTCGTAGATGTATC
>probe:Drosophila_2:1639233_at:674:35; Interrogation_Position=3621; Antisense; ATCAGGATCGATGTACAGGTTCAAT
>probe:Drosophila_2:1639233_at:604:131; Interrogation_Position=3665; Antisense; ACCGTCAGCTGGAGGCCGTGGTCAT
>probe:Drosophila_2:1639233_at:693:723; Interrogation_Position=3759; Antisense; TTGGGAGATTCCGTTCGTGACCGCG
>probe:Drosophila_2:1639233_at:137:697; Interrogation_Position=3813; Antisense; TTTCGAGGCCATTCGCATGATGCAC
>probe:Drosophila_2:1639233_at:478:331; Interrogation_Position=3854; Antisense; GCTGGTCCGGTGACTCCACGGTGAA
>probe:Drosophila_2:1639233_at:258:595; Interrogation_Position=3905; Antisense; TGGGCGCAGAGCAGGACTACGACAA
>probe:Drosophila_2:1639233_at:420:397; Interrogation_Position=3925; Antisense; GACAATGCCATCGTTGTGGTCCTCA
>probe:Drosophila_2:1639233_at:716:325; Interrogation_Position=3950; Antisense; GCGATGCCAATCTGCAGCGCTATGG
>probe:Drosophila_2:1639233_at:426:681; Interrogation_Position=3970; Antisense; TATGGCATCGCACCCAAGGATCTGG
>probe:Drosophila_2:1639233_at:641:223; Interrogation_Position=3985; Antisense; AAGGATCTGGCTATGGCGCTCAAAC
>probe:Drosophila_2:1639233_at:343:645; Interrogation_Position=4040; Antisense; TCTTCATTGGCAGTCTGGCCGAGGA
>probe:Drosophila_2:1639233_at:254:167; Interrogation_Position=4085; Antisense; AAATGCCGGCTGGTCAGAGCTTCGT
>probe:Drosophila_2:1639233_at:175:103; Interrogation_Position=4100; Antisense; AGAGCTTCGTGTGCATGGACCTCAC

Paste this into a BLAST search page for me
GGCTTAAGCTGGTCGTAGATGTATCATCAGGATCGATGTACAGGTTCAATACCGTCAGCTGGAGGCCGTGGTCATTTGGGAGATTCCGTTCGTGACCGCGTTTCGAGGCCATTCGCATGATGCACGCTGGTCCGGTGACTCCACGGTGAATGGGCGCAGAGCAGGACTACGACAAGACAATGCCATCGTTGTGGTCCTCAGCGATGCCAATCTGCAGCGCTATGGTATGGCATCGCACCCAAGGATCTGGAAGGATCTGGCTATGGCGCTCAAACTCTTCATTGGCAGTCTGGCCGAGGAAAATGCCGGCTGGTCAGAGCTTCGTAGAGCTTCGTGTGCATGGACCTCAC

Full Affymetrix probeset data:

Annotations for 1639233_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime