Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639235_at:

>probe:Drosophila_2:1639235_at:15:145; Interrogation_Position=2805; Antisense; ACTGATCCTCGACCTATCGACGCAG
>probe:Drosophila_2:1639235_at:385:43; Interrogation_Position=2820; Antisense; ATCGACGCAGGCAGCTGAGCATCTA
>probe:Drosophila_2:1639235_at:361:419; Interrogation_Position=2836; Antisense; GAGCATCTATGCTTAGTAGTCCGCT
>probe:Drosophila_2:1639235_at:433:335; Interrogation_Position=2858; Antisense; GCTGCCCAACACTGTGATGCCAAAA
>probe:Drosophila_2:1639235_at:461:209; Interrogation_Position=2888; Antisense; AAGAAGCCCACTAAAACCACTCACT
>probe:Drosophila_2:1639235_at:133:633; Interrogation_Position=2912; Antisense; TCCCCTCCAGACACAATTAGCGTGT
>probe:Drosophila_2:1639235_at:633:161; Interrogation_Position=2924; Antisense; ACAATTAGCGTGTAGTTAGGCGTAA
>probe:Drosophila_2:1639235_at:703:663; Interrogation_Position=2978; Antisense; TACAACCTAGGCATTAAGTCAGAGA
>probe:Drosophila_2:1639235_at:586:387; Interrogation_Position=3001; Antisense; GAAAATCTTGCCTTGTACATACTTA
>probe:Drosophila_2:1639235_at:504:663; Interrogation_Position=3030; Antisense; TAAAGCACTCTTTCGAACCTATAGA
>probe:Drosophila_2:1639235_at:319:77; Interrogation_Position=3062; Antisense; AGGATCTCCAATTCTATCAGCACTT
>probe:Drosophila_2:1639235_at:717:245; Interrogation_Position=3071; Antisense; AATTCTATCAGCACTTTGCCAACAC
>probe:Drosophila_2:1639235_at:128:721; Interrogation_Position=3086; Antisense; TTGCCAACACTACTGTTTTCCTCGT
>probe:Drosophila_2:1639235_at:178:355; Interrogation_Position=3187; Antisense; GCACTGAGAGTCAACGTAAGCTTAA

Paste this into a BLAST search page for me
ACTGATCCTCGACCTATCGACGCAGATCGACGCAGGCAGCTGAGCATCTAGAGCATCTATGCTTAGTAGTCCGCTGCTGCCCAACACTGTGATGCCAAAAAAGAAGCCCACTAAAACCACTCACTTCCCCTCCAGACACAATTAGCGTGTACAATTAGCGTGTAGTTAGGCGTAATACAACCTAGGCATTAAGTCAGAGAGAAAATCTTGCCTTGTACATACTTATAAAGCACTCTTTCGAACCTATAGAAGGATCTCCAATTCTATCAGCACTTAATTCTATCAGCACTTTGCCAACACTTGCCAACACTACTGTTTTCCTCGTGCACTGAGAGTCAACGTAAGCTTAA

Full Affymetrix probeset data:

Annotations for 1639235_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime