FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639236_at:

>probe:Drosophila_2:1639236_at:335:81; Interrogation_Position=167; Antisense; AGGGTGGACAACAGGGAGGCCAGCA
>probe:Drosophila_2:1639236_at:641:71; Interrogation_Position=272; Antisense; AGGCTAGCACCACTGAATCCAGCAC
>probe:Drosophila_2:1639236_at:630:141; Interrogation_Position=283; Antisense; ACTGAATCCAGCACCACTGACGTTT
>probe:Drosophila_2:1639236_at:34:367; Interrogation_Position=286; Antisense; GAATCCAGCACCACTGACGTTTCCT
>probe:Drosophila_2:1639236_at:203:129; Interrogation_Position=295; Antisense; ACCACTGACGTTTCCTCATCATAGG
>probe:Drosophila_2:1639236_at:419:143; Interrogation_Position=298; Antisense; ACTGACGTTTCCTCATCATAGGAAG
>probe:Drosophila_2:1639236_at:452:407; Interrogation_Position=301; Antisense; GACGTTTCCTCATCATAGGAAGCTA
>probe:Drosophila_2:1639236_at:632:479; Interrogation_Position=304; Antisense; GTTTCCTCATCATAGGAAGCTAATC
>probe:Drosophila_2:1639236_at:404:561; Interrogation_Position=318; Antisense; GGAAGCTAATCAAAAACTCTTGTAT
>probe:Drosophila_2:1639236_at:683:179; Interrogation_Position=330; Antisense; AAAACTCTTGTATTAATCGATCCTG
>probe:Drosophila_2:1639236_at:597:193; Interrogation_Position=332; Antisense; AACTCTTGTATTAATCGATCCTGTA
>probe:Drosophila_2:1639236_at:362:281; Interrogation_Position=334; Antisense; CTCTTGTATTAATCGATCCTGTATA
>probe:Drosophila_2:1639236_at:404:481; Interrogation_Position=339; Antisense; GTATTAATCGATCCTGTATATAACT
>probe:Drosophila_2:1639236_at:168:41; Interrogation_Position=345; Antisense; ATCGATCCTGTATATAACTAAAGAG

Paste this into a BLAST search page for me
AGGGTGGACAACAGGGAGGCCAGCAAGGCTAGCACCACTGAATCCAGCACACTGAATCCAGCACCACTGACGTTTGAATCCAGCACCACTGACGTTTCCTACCACTGACGTTTCCTCATCATAGGACTGACGTTTCCTCATCATAGGAAGGACGTTTCCTCATCATAGGAAGCTAGTTTCCTCATCATAGGAAGCTAATCGGAAGCTAATCAAAAACTCTTGTATAAAACTCTTGTATTAATCGATCCTGAACTCTTGTATTAATCGATCCTGTACTCTTGTATTAATCGATCCTGTATAGTATTAATCGATCCTGTATATAACTATCGATCCTGTATATAACTAAAGAG

Full Affymetrix probeset data:

Annotations for 1639236_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720