FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639237_at:

>probe:Drosophila_2:1639237_at:707:159; Interrogation_Position=332; Antisense; ACAACTGTTGAACTTGCGGCTTCCA
>probe:Drosophila_2:1639237_at:638:621; Interrogation_Position=346; Antisense; TGCGGCTTCCACCTGGGTTTTCGTT
>probe:Drosophila_2:1639237_at:684:57; Interrogation_Position=379; Antisense; ATGATCCGTCTCACATTTTATTTGT
>probe:Drosophila_2:1639237_at:584:413; Interrogation_Position=438; Antisense; GAGCCAAAGGAACGTACTTCACCGA
>probe:Drosophila_2:1639237_at:729:445; Interrogation_Position=492; Antisense; GATGCGACAAAACTCCGTTCGACGA
>probe:Drosophila_2:1639237_at:79:393; Interrogation_Position=524; Antisense; GAAAGATCCGAAACCACCGACTACA
>probe:Drosophila_2:1639237_at:82:129; Interrogation_Position=536; Antisense; ACCACCGACTACATTCACTTATTTT
>probe:Drosophila_2:1639237_at:423:349; Interrogation_Position=758; Antisense; GCAAGAATCGCTTTTGAAAACGCCT
>probe:Drosophila_2:1639237_at:357:165; Interrogation_Position=794; Antisense; AAATCGCAAGCGTTTCCACCGGAAG
>probe:Drosophila_2:1639237_at:368:375; Interrogation_Position=815; Antisense; GAAGAGAAATCTCGTCCGCCATGAT
>probe:Drosophila_2:1639237_at:134:39; Interrogation_Position=823; Antisense; ATCTCGTCCGCCATGATGTGATGAT
>probe:Drosophila_2:1639237_at:548:441; Interrogation_Position=845; Antisense; GATGGGCTCGCCGTACAACGAAAAG
>probe:Drosophila_2:1639237_at:147:215; Interrogation_Position=867; Antisense; AAGATTCGGGATCTCGTGCAGTCCA
>probe:Drosophila_2:1639237_at:603:505; Interrogation_Position=882; Antisense; GTGCAGTCCAGTGGCCCTAAAGAGG

Paste this into a BLAST search page for me
ACAACTGTTGAACTTGCGGCTTCCATGCGGCTTCCACCTGGGTTTTCGTTATGATCCGTCTCACATTTTATTTGTGAGCCAAAGGAACGTACTTCACCGAGATGCGACAAAACTCCGTTCGACGAGAAAGATCCGAAACCACCGACTACAACCACCGACTACATTCACTTATTTTGCAAGAATCGCTTTTGAAAACGCCTAAATCGCAAGCGTTTCCACCGGAAGGAAGAGAAATCTCGTCCGCCATGATATCTCGTCCGCCATGATGTGATGATGATGGGCTCGCCGTACAACGAAAAGAAGATTCGGGATCTCGTGCAGTCCAGTGCAGTCCAGTGGCCCTAAAGAGG

Full Affymetrix probeset data:

Annotations for 1639237_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720