FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639239_at:

>probe:Drosophila_2:1639239_at:266:73; Interrogation_Position=1027; Antisense; AGGACAACTCCAGCGACGTGGACAT
>probe:Drosophila_2:1639239_at:73:43; Interrogation_Position=1050; Antisense; ATCGTCGGCGATGCGAAACTCTACC
>probe:Drosophila_2:1639239_at:325:325; Interrogation_Position=1062; Antisense; GCGAAACTCTACCAGTTAACATAGA
>probe:Drosophila_2:1639239_at:542:661; Interrogation_Position=1078; Antisense; TAACATAGACAGTTCGATCGGGATG
>probe:Drosophila_2:1639239_at:519:451; Interrogation_Position=1093; Antisense; GATCGGGATGTGGACCTGGATCCTA
>probe:Drosophila_2:1639239_at:212:187; Interrogation_Position=1242; Antisense; AACACATATATTATCAGCGCGAGCA
>probe:Drosophila_2:1639239_at:383:35; Interrogation_Position=1254; Antisense; ATCAGCGCGAGCATGGTTATACCAT
>probe:Drosophila_2:1639239_at:469:159; Interrogation_Position=781; Antisense; ACAAAAAGCAGCTGCGCCGGCGCGA
>probe:Drosophila_2:1639239_at:609:321; Interrogation_Position=800; Antisense; GCGCGACAATGCCAATGAGCCCGTC
>probe:Drosophila_2:1639239_at:559:643; Interrogation_Position=829; Antisense; TCTCACGCAGCGAACCGGGCAAGCA
>probe:Drosophila_2:1639239_at:434:195; Interrogation_Position=898; Antisense; AACTGAATCCCGGATCTGTCGGCGG
>probe:Drosophila_2:1639239_at:346:113; Interrogation_Position=949; Antisense; AGCAGCTGCAGATGTGCCTGATGCA
>probe:Drosophila_2:1639239_at:103:447; Interrogation_Position=968; Antisense; GATGCAGCAGGGTTACTCCACGGAT
>probe:Drosophila_2:1639239_at:420:141; Interrogation_Position=987; Antisense; ACGGATGACTACTCCGATCTGGAGG

Paste this into a BLAST search page for me
AGGACAACTCCAGCGACGTGGACATATCGTCGGCGATGCGAAACTCTACCGCGAAACTCTACCAGTTAACATAGATAACATAGACAGTTCGATCGGGATGGATCGGGATGTGGACCTGGATCCTAAACACATATATTATCAGCGCGAGCAATCAGCGCGAGCATGGTTATACCATACAAAAAGCAGCTGCGCCGGCGCGAGCGCGACAATGCCAATGAGCCCGTCTCTCACGCAGCGAACCGGGCAAGCAAACTGAATCCCGGATCTGTCGGCGGAGCAGCTGCAGATGTGCCTGATGCAGATGCAGCAGGGTTACTCCACGGATACGGATGACTACTCCGATCTGGAGG

Full Affymetrix probeset data:

Annotations for 1639239_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720