Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639243_at:

>probe:Drosophila_2:1639243_at:670:399; Interrogation_Position=2079; Antisense; GACAGCCTGAGGACTCATTTTTACA
>probe:Drosophila_2:1639243_at:21:461; Interrogation_Position=2125; Antisense; GATTATTTCACCAGATCTACGGTAT
>probe:Drosophila_2:1639243_at:728:249; Interrogation_Position=2206; Antisense; CAATGTTTTCACACTGTTGAGATGA
>probe:Drosophila_2:1639243_at:369:237; Interrogation_Position=2234; Antisense; AATCGTGTCGATGCAAAAGCACAGC
>probe:Drosophila_2:1639243_at:565:171; Interrogation_Position=2249; Antisense; AAAGCACAGCTTTTTCAAATCGGGT
>probe:Drosophila_2:1639243_at:538:33; Interrogation_Position=2310; Antisense; ATCAGTTTGCCAAAATGGGTCTGGG
>probe:Drosophila_2:1639243_at:259:531; Interrogation_Position=2333; Antisense; GGGTTCGATTTTAGTATCATTTCGG
>probe:Drosophila_2:1639243_at:532:539; Interrogation_Position=2356; Antisense; GGTATACTCCATTTGAATTGCCATA
>probe:Drosophila_2:1639243_at:266:149; Interrogation_Position=2448; Antisense; ACTTATGTTTAGTGCTCTCGCTTAA
>probe:Drosophila_2:1639243_at:409:507; Interrogation_Position=2459; Antisense; GTGCTCTCGCTTAATTATAGTTTTG
>probe:Drosophila_2:1639243_at:273:571; Interrogation_Position=2492; Antisense; GGCTATTTGTTTTTATTCGTAACTG
>probe:Drosophila_2:1639243_at:101:541; Interrogation_Position=2580; Antisense; GGTTTTTTGCTATTTTACACTTGCT
>probe:Drosophila_2:1639243_at:234:665; Interrogation_Position=2595; Antisense; TACACTTGCTTGTTTACAATTCGAA
>probe:Drosophila_2:1639243_at:123:383; Interrogation_Position=2626; Antisense; GAACAGTATTAAAAGGCCAAGGCGA

Paste this into a BLAST search page for me
GACAGCCTGAGGACTCATTTTTACAGATTATTTCACCAGATCTACGGTATCAATGTTTTCACACTGTTGAGATGAAATCGTGTCGATGCAAAAGCACAGCAAAGCACAGCTTTTTCAAATCGGGTATCAGTTTGCCAAAATGGGTCTGGGGGGTTCGATTTTAGTATCATTTCGGGGTATACTCCATTTGAATTGCCATAACTTATGTTTAGTGCTCTCGCTTAAGTGCTCTCGCTTAATTATAGTTTTGGGCTATTTGTTTTTATTCGTAACTGGGTTTTTTGCTATTTTACACTTGCTTACACTTGCTTGTTTACAATTCGAAGAACAGTATTAAAAGGCCAAGGCGA

Full Affymetrix probeset data:

Annotations for 1639243_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime